Description :
From Genome Similarity Track
Location :
Scaffold_1699:102- 4769
Transcript NameFunction/comments
Phypl_g13988hypothetical protein

Sequence
4667 bases(100 bases per row)
ATCCAAGGAATTTGGCCCACTTTATCACACATATCGTAGCCcgacgccgccttcgccaccTCCCATTGGGGTAGCCTCTAGACGACCGCACCAAATGCAC
TTCCTTCCCTCTTGGACTTCGCCGAACCATCGAAACTTAGCACATGCAACACTTCCCCGTCCCCAATCTGAGGGAACGGAATTACCGTGATCTTGGCCGG
TCGTCTTCGTGGCGCAATGTCTTTCAACGCCGCATCTACCGAATCTCGTGGGGTGATACTGGCAGCAATCACCTCGAGTATctctgcttctccacgatcG
GATCGCTCAATCTTGAAACTCCAAGAGGACAACCTAGCCGTCCACTGCGATAACCGGCCTTGTAAATTCTTCGAACGGAATAGCCATGCTAACGTCGTAC
GACCGGATAACACAAGGATCTCTTGTCCGGCCAACATCGTGAAGCACTCGTCTAGTACTTGAAGTAATGACAAGATCTCCTTTTCCACCGGATCGTAGTT
CAACTCGTTCGGTTTCAGCGGACGGCTTACGAACTCCACTGGCATGGATACCCCGTCATGTGCTTGGGTTAATGCGGCCGCCACGGCCCAGTCGTTAGCA
TACAAGATGACTACCGGTTCCCGTTCTTGGTCGTAATGCCGCAGAATTGGAGTCATGACCACTTTGTGCTTAAGTATCTCGAACGCtgtggcggcgctgg
tccaCTTCTCATCCGGTCCGCTCGACGACGTTTCCAATTCGCGATGAAGTCATCTTCCGTTAGCGCGTATAGAGATGCTGCATAGACCGCAAAATTATCC
ATGAACCTGTGGTAGTAGTTCAAGCTACCCAAAAAGGACTGTAGACCCTTCAGAGTCTACGGGAAATCGAGCGCCACTAGCGTGTCCAAATTCTTGGGTT
GGGCCGCCAAACCGCGTCGTGAAACCGCATGACCGAGGTAGTCGACTTATCCATTCCCCAGTAGCTCTTCTCGACACTGATAGACAGTTTACAACTCTCA
TAAGCGTCCAACAGACGTTCCACCTTCTCACACAAATCCTTCCAGGTCGTTCCTCCAATGAAAATATCATCAATGTACGACCTTCGGCTCAGAATGGAGG
GTCTCCTAGCATCTTCGGCCTCGCCTTTGGTAAAAACGTCCTGAACGGGGGCCGTCGGGATTCAACGGAAACCGTACAACGCATTATCCACCAGTCTTTG
ATAAATCTGCGGCGCGTCCTTGAGGCCGAACGGCATACGCAGCCACTCAAACAGCCCGAACGGGGTGATGAACGCAGAGATTAGTCTTGCCCGGTCGGTC
ATCGGGACAACCCAGAACCCACTGGCCATGTCCAGCGAACAGTACCAAAGGTAGGGGTTTAGATCTTCCAACAAGTCACTGACCAGAGGCATCGGATTCA
TCATGAGCTGCGTCAAACCGTTGACCAGACGGTAGTCGATGCATAGGCGGATGTCCACtccgttcttcttgatgatgACCACAACCGGTGACGCCCAAGG
CGAAATAGACGGTCGGATCATCCCTGCACTCAGAAGTCCCTTCAACAACTCAGACACCTTCTCGCGAAAACATGGTTGTATCTTCCGTACACGCTGGGCG
ATCGGCTTTGCATTTCCCACGTCGATATCACACACCACACCGATCGCGGCTGGCGGCAACGCGTTGCTCTTCCCGATCATCCACTTGCGACGTCTCCAAA
TAATCCGACGCAACCGCTCTTCCTGTTTGGCATCTTCCTTCGGAAACTTCGACTTTGGTCTCCCAACCTTGACGTCGTCTATCGTCACGTCGGCGGTTAA
AGACACATCAGGTAGGAACGCCATCTCCTGTTCCATATCTTCCGCGAACAAATTGGACGCTTCGTGATAGAACACCTCATCGTAGCCCAAATCCGGATCG
GTCATCGTCGTAGTTACAGCGACATCCGAGAtagacggcgctggtggagtcttctccttctcggGTGAACCGGGTGCCTTGTCCTCGTCACGATCCGGGT
CGGAACGCTTCAAGGACAACGCGACTTCTGCTTGATCCACAATGTTTGGGCCTTAGCGTCCGGTTCGTTTGAAACCGTATCACTTAAGCCTTCCGAGAGC
ACGTGGATACTATCTACAGTCACCACCCCGTGTTGCACCTCATCATCGATCTCGGTTTCTTCCGTTCCCGTTCCCGTTCGCCTTCCGTTTCCGTTCTCAG
ATCGGAGTaccgccaccgccacttGAAGGGGGGTTCCTCCTCGTCGCAGAGTTGCCTTGGGGGAGCGTATTGCCGTCGTTCCGTCATAGGtcctgcatct
ccagcatcgaAGAAATCTCCGTTCTCCACCGCAACACCGTACATAAGGTTCTGCCACTCTTGATATCGGCGAGAGCCAATCCGCACAAAACCGTATTCAC
GAGGTAGCTGGTCTTTTGCAACCCACATCGCAAGTTTGGTGTGCGTATCCAGCGTCAACTGTGAGTCGGTCAGATTCGTCCCGATCGCCCGTTCACCACT
GTAGTAACCCAAGTCTTGCCTCGCGTGACCCAACAGAGTTTGTTGATCACGGGTGTCGTTCTGGAGACGAACGTTTTGATCTTGATGTACTCCAATCTGG
ATCGGACTCGTCGGCGTAACGAGACGCGTTCTAGGTCCGTACAACGGACGTCGGCCAAGCATGTGAAGACGGAACTCGTCTGGTAAACACACCGTTCCAT
CGCCTGCATCGAGACCGATACCCGCCGGGACCATGAGATCCATTCCCAGGATCGCGTTCTGGCCCGCGAGATCACCGACCCAAGCCTAAAAAAGTAAACG
AGGTTGCCGGCCAGGGTAACCTTCAGTCTTGTTCTTCCAACCGTGTAGTACGTCTCGTCTCTAATCCCCACACATTCTTGCGTTCTGTCTGTGTCAATGG
GGCAGCCTACCTCACGAGCAAAGTCGGTGTCCACAATAGACACCTCGGCACCACTGTCGAGCAACAGAATAGCCGGATGATTATCCAACTTCCCTTTGAC
CTTGGCCTGGCGAAACCACTTCTCAGGAGCGTGGTACTTCCAATATCCACGTTTCCCTCCGGGAAGTAGTTCCATGACCGCGATTGGAAACGCGCGTGCA
AATTCATCGTGATCTCGACGTAGACTTAACACCTTGGAGGCTAGTAGTCGGCTGAAATCACATGTATTATCGAGAGATGTAgactcctcttcctcttgca
cCGAACGCTTGTCAACAAATGCATAGACTAAACAGACCGTTCGGCTCGTACTGGTTTCCACACCATCGAGCGATCTAGTTTAACATCTGCTCCGCCGTCG
GTGGTAGCATCCCTGTGTGCTTGGACGGGTTATATCACTGACGTAAGAGGTTGAAGAACTCTTCCATCGGGcattctccagcagcatggacGTCACCACG
CGCCTTGCAGACGCGAAGGCAGCGATCGGACGGATGACGACCGCCACATTTGGCACacgtcagcagcgtccagcagTCCGACTCAGGATGGCGTGTCGAG
TTGCAGTGAGAACACGGAGGGTGCATTGTGCGGTCCATTCTCCGTTGGATCGTCACGGCGAGACACAGCTTCGGGGCTCCGCTGGGCGGTGACACAAAGT
CTAACCCGTTCCGCATCTTCGAAGTCCTGTCCGTAGTCCCACTCGTTTTCCGGTTTGGCACTGTCACGCTGGCTGGTCCCATCTGAGACTCCGGTCTGGA
CCGCATGGACGGCCCGTGGAGGCGCGGCTGGGGTCGGAGCCTTCTGGCGAAACTTGGTCGATCCGAACAGTGATTTCTTCTAGTTATCCAGATCTCGTTG
CCTCTTGCGGAGCACGGTTTCTGTAATGGGCCTTCCAACAGTTATATAAGTAGTTAGATATTACATAAGTGGTCATAGGTACACCCGGATAGCGGGTGCA
GAGNCCCCAGTCTACAGACTTGGTCTCAGTTCCCTGAGTCCTGTTgcaagcttcctcatcgctacgTGTAAGCTAGTGACGTTAACCACCTAGCCCGTTA
CAGTTTCAAGGGTCAGCACATCAGGTACCATAAGCATGGTTAACTGCATGGTAAGTTCGGGCTCCTGATGGTTCAGGGTTCGCACATAGTGTTCTACGTG
TTCGCGTTTCTGCTCCGCCGATCCTTCTATGAAGTGGAGTCCGGCGCGAAGGCCAGCCACATTCAAACGGTACAGATATTCCAACGGGGTCTCGTCCGAC
CGCTTGGTCGCATGGTAATAGCGGCTTGCTATCGATACTCCTTTTCCGCAGTATTGGATCAGGAACTGGGCGGTCAGCTTCTCCCAAGACGTTCGCGTCT
CCCGGCCGAGTTGGAGGTACCATTGTCGGGCCAGACCGGTCATCAAATCACCGAAAAGACTACACACTTCACTGGGGCCCATGTCATCACGGCGGGCGGC
CGAATGGAGTCTGTTAAACCAAGAACGCGACTTCTCCTCACTGGCATCTCGGCCGCTGAACTCCTTCAGTTCCGAAAACGCCGACATCCGTACACGGGCA
AGGGAGGGTTGGCTTAttccagccgccgccgctgccgctacAGTAGGACGCCCGGCCAGTGTTCCGCCCAGATCAAAGAAATCTTCTGGATCGTCGGACA
TACCGTTCCGCTCCCGATCGGAGCTGACCATCGAACTGACGGACTCCATCGGTTCATCTTGGTCTTC