Description :
From Genome Similarity Track
Location :
Scaffold_2722:102- 2119
Sequence
2017 bases(100 bases per row)
ACTCTGGTGTCCGAAGATCTCCGTAGTTCGCTGGCGACACACCCGTTCACTTCGGTGAACGAGCTGCAGAAAGTCCTCGAGAAACTCGAGAATCTCCAGA
ATAGGCGTGAGTCGAGCCGGTCGTTGAGCCGAGACCGGAAGCGTGAGCGCGAACGCGCACGAGAACGTGAACGGAGCCGGGAGCGTGAGTCGCGGGACCG
GTCAATCCCAAGGTCTGCCGCCGTATACTACACGTACGACAGCGACCGTGGCAGCTTCGAGCCGGTGGACAGCTCTGCGCGCGGAGTCCACTTCGAGGAT
GACGAAAAACCAGATTCTGACGCCTCCGACGGTGAGCTGGTCTACCAAGCTCTCGGCCAGAGTGCGGCGAGAACCAGCTCTGGCTCGAGCAACCAGCATC
TCCCGAAAGGTCTGCCTCCGCGACCGGCATTCGGAGCTGGTCAACAAGTCGCTGGTGTCTGTTACAAGTGCGGGCAGCCGGGGCACTTCGCCAGAGAATG
TACGACTAGCGAGCCGGCGACCAGCGCTCTTAAGGAGCCCGCCAAGAAGCCGTGCCTGCTCTGCGAGTTGGTTCACGGACCAGGCGAGTGCGAAGTGAAC
AACACGCTCGCCGAGATCANNNNNNNNNNNNNNNNNNNNNNNNCCAATGGCTGGAGCTGGTCCTGCTCCGGCCATTCCGCAGCAGCCTTTAAACTAGGCA
GCTCGCCGGGGACTCCAGGGGATCCGGTACGCGCCGAGCATCAAGTCCCTGAAGAAGCGACACCCGATGCCAAGCCTCTTTGCGTGTTTGCATATGTTGG
TATAAGCCTAATACCAGCAACCAGTCTACCGATTTGCATGAAGATGAAGCGCGTTCATACCTTGCAACTGCTGGTGACATTGAGGATTCAGGTCGAAGTA
ACCCCCTTCACCTTCGACCTGGGGAGCGTCGTGGCTGGTGGTCTCACCATCCAGATCCGGTCGACAAGACGACGGTCGCGCTGGTTCACGGCGCGGTCAA
CGACTCCCGAGTCACGATCTTGCTGGACACCGGTTTCACGACCAGCATCCTCAGCCTCGACCTAGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCATCTCCGTGGCCAGTCCCCACGATCTGTACGTGCTACCAGGTCGCACCGCGCTCGCCCCCG
TAATCTACGGGTGGGGTCAGNNNNNNNNNNCTACGACCGGCCCTACCGGCTCGCATCTCTGTAGCCAGTCCCCATGATCTGTACGTGCTGCCAGGTCGCA
CTGCGCTGGTCCCCGTAATCTACGGGCGGCGTCAAGCTGGTCCGGACTGGACAGTCTGGGCTAGTCGTGGGCCGGATTGGGTTACGACAGTCCTGCTCGA
CGAAACCGGTGCGCCGGACTACATCTGCATCACGAATGTGTCGAACAGGCTCATCACGCTTATCAGTCGCACGCCGGTCGCGCACTTGGTCGAAGACGGC
CATCTACCACTCGGAGGTTCGTGCGCGCGAGTGGACTCCGCGCGTTACAAGGAGTGGCAAGCGCTCGCGTACGAGAACTCGTACTCGGAAAACTTCGCTA
GGCGGTTAGACCAGAGCGATGACTTGTTCAACGCCAGCCTGCCACCCCCAGTGGTGAGACCGACGTACGCTGTGCCGACGAAGATCTTGCCAAGGGGCGC
GGGGAAGGAGAGTGTCCCAAGTCTTGTCGGTACACCACACGTCGAGAACATCGCGATGAAGGCGACCAGTTCAGTCGATGGACCAGCCCTGGTGGCTCCG
CAGGCGAGAAAAACAGC