Description :
From Genome Similarity Track
Location :
Scaffold_2006:102- 1958
Sequence
1856 bases(100 bases per row)
GATCTCGTCACGCTGAACCGACTAGACGAGGTGGTGGTGGCTGGATCCGAAAAACGGACAGTACAGGTAATGGCTGTCACTAGGTCCAGAGGAAGGATTG
GATCCAGCCACCAGATCCTCGTGGAAACATTTGTGAAGGGGGTCCGCATCGAGCGGATCCTCAAAGCACAGAACAAGGAAGCGTGGATCCTAGGACTAAA
GAAATATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATACCAAATACTACAGTAGTATCGCTACGGATTACGCAATGGATCTGAATGACTTGCTC
TTCTATTGTCCCCCTACGAAGAGAGTCGACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCAAAAACCTTACAACAGGACGTCCTACATCACTATC
ACGCTAGTTTCGAAGGCGGAATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACGGTAT
GTCGGGGAATGTGTGGATTGTGAGACAGGCAAAGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAG
CCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGGTAGCCAAAGCTAG
TGCGTCTAGAACTGCGCAGACCATTGCTGAATCGTACGAGGAGTGCGTTTTTCGAAGATTTGGGGCTAGCGAGATGATTGACATGATCGGGAGCCAGGCT
TTATGTCCGATTTCTTTCGAGCCTTCAACCGGATCCTGGGGCAGAGACAGCAGGCGACTATGACATATCGTCCCCAAGCCAATGGATCGGCCGAACGCAT
GGTACAGACGATCACGATGGCGCTCAAGATGTATGGTCAGAACTTGGATTAGAGGGATTGGGATGAGTACGCAGAACGACTCACCTTCGCAATGAACACC
GCCCAGGACAGGATCCGGGGCGATACTCCATTTTACTTGGTACATGGGTGGGATCCTAAATCTACCCTAGAAGTGGCCATTCCGGTATGTAGCACCAAGA
AGAGAAACCGAGATCCCAGACGATGGCGATACCAAGTCCAGAAATATTACCACAAGCCAGATCCCAAGTGAACGAACGACTGCGGAGTGCGATACAGGAT
CGAGCGGATCGACACAACAAAGACGCTCGTCCCCATCAAATCCAAGTGGGATCGCAGGTGTGGCTATATTTAGATCGGGTGCAGGAAGGGTACGCCCGCA
AATTGGCCCATCTATGGCACGGACCGTTCCGGGTGAGCGAAAAGATAGGGGAGCATGCGGTGAAGTTGGAAACGGCAGGTACCGAATATCGCTTGCTCCC
TGTAGTACACGTATCCAAACTGAAGTTGGTCAGGAAATATCCGGACCGGCCGCAAACCCGTCTTTCGGTGGATGAATCCGACCGGGAGGATTTCGACGAA
GTACTCCTACCTGAAGATAGTTGGAAGGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCAAGGAAGCGAACTAGGTACG
GACGGATTTACCGTGAATTTCTGGTGTACTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGACAGATCTGAACTATGGAGCATTACTCTATGATTC
TTGCGGGATCGTACGAATCGGAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAGAGGAGCCATGGGTGTGAGTCGGTCATGTCGATGGGA
GTATGAAAAAGGACCCCCAGGAAGGGTGTGGGTCAGGAGGAGGAGGATCACTGGTG