Description :
From Genome Similarity Track
Location :
Scaffold_3826:102- 1753
Sequence
1651 bases(100 bases per row)
CTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTAGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGTT
CGTTGCCATGTATAGGAGCGACTTCTCCCATTTGAAAGACTCTCAGTTCGAGTCGGTTCGGAAAATGGCAGGCATCTTCGGAATGGAGGCCCTGCAGAGC
CTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTTGACGCGTACGAGCAGGGCCCGTACTGCGCATATGCGGGAGAACCTGCAGGCT
CCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAG
AAGTAGAGCTCGCGATGGACACGGCTCTGATCTCGACCGAGCAACTGCGTGCTGATTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGTTGGGTGTA
CACTCGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAGCAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAG
CGTTCGCGCTTCCTCGCGTGTAAGCAAGGTAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGTGTCCCTAGTGGGAAACCCACTCA
ACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGTCCCGCACGCACTCAGCTGTTTTGGGTGCAGTCAAGCACCCTTGAAGAGGCGAT
TCAAGCGGCTTTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGCTCCTTGTCGGCTCCCGGTTGAACAAGCCCT
AACGGACCAGTTTCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGG
AAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCTTCAAGGGTCGCTGGCAGAAGCCAGGATACCGGGGACAGGGGAACGCCGGGAACCAGTAGGGGCG
GGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGCCGCGTACCACGGGGACCTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGG
CGAAGAACAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGC
ACGCCGCCAGACGGTTGCTCGTAGCAGCAACAAGTTTTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAG
GTCGTCACTGTCCCCAACATCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATA
TGATCCTGGGCATGCCCTGGCTTGAGAAGTACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATT
GGTGAGTCATGTTCCACCCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTG