Description :
From Genome Similarity Track
Location :
contig_65:101989- 103367
Transcript NameFunction/comments
g9515.t1hypothetical protein PHYSODRAFT_499448

Sequence
1378 bases(100 bases per row)
AGCATGAAGGCGTGGCAGATCCAGTCGCAGGGGCTCATCGTGCTGCTGTGCCTCGTGAACCTGCTCAACTACGTCGACCGCGGTATCATCCCGGGAGCCC
CTCAAAGCTTCCGCCACTTCATCACGTCGTCACTGGGCGTGGCGGTCACGGGCCAGTCCGTGTACTTTGGGCTACTGTCGTCGGCATTATCATCGGGCAC
TCGGTTTTGTCGATCGTGTTCGGGTACTTCGCACTCACGCACCGGCCGTTCCGGATCATTTCACTGGGGACGAGTGTCTGGATCGTGGCCATCGTCATCT
GCGCCATCTCGGAGCATGTCGACAGCTACGCACTGCTGATTGTCGGTCGAGTGCTCAGTGGCGTCGGGGAAGCTTCGTTCCAGTGTGTGGCGCCCCCGTT
CATCGACCGTCACGCACCGCCTGCACGTCGGTCGCTCTACGTGGGGATCTACTTGGCGTCGGTCATTGTGGGCACCGCCATCGGCTTCGTGTACGGCTCG
TTGTTCGCTGAGTCGGCGTTGACGTGGGCCGGCGCCTTCTACTTTGAAGCCATCCTGATGGCGTGTCTGGTCTTCTGCTGCTTGTTCTGCGTGCCGGACG
AGCTCAACGTCGTGCCACCGACAGACGACGCAGTGGCATTGAGGAAGCCGCTGGCGTCGACGAACGAGTTCGCGAGCGAAGTCCTGTCGTGGTCCAGAGA
GTCTCGCGAGACAATTGACAAGAACCACGCAGAACTGCTGTCACCCGAGGAATTCGGCGAGAAAATCGGGCCCGAGACGTTCTTCCAGACGTGGTGGGGG
ATTCTGTCGGACGTCCCCTTCTTGCTGGTGGTGCTCGCGCACGGAGCGTATACGTTCACACTGGGGGTGTTCAACGCCTTTGGGCCGGACGTGTTCATTG
GCTTGGGCTTGTTCTCGGATGAGACGTCGGCGTCCTTGATCTTTGGGGGCATTGTGGCAGTGACGAGTCTCGTTGGCACGCCACTCGGTGGACTCGTGCT
GGATCGCTACACGAAGCACACCACCGTGCCGGGCAAAAGGTGCTTCATTGCGGTCTCGTCGCTCTTCGTCTACGTGACTGTCGCCGAGGTGTTCGCGCTC
ATCATGTGCTTCATTTCAGACAGCAAAGGCGCCTTCCTCGCGTGCTTCACCCTCGCTCTCTTCTGCATGTGTGCACTATGGGGGCCGGAGATGGTGGCGG
TGCTGGAGCTCTTCCCTTCCTCGCGGCGATCCATGGCCATTTCAGCCAACGCAGTGATCATCCACGTCTTCGGCGACGTGCCGGCGCCAATTGTCATGGG
CGTCGTGAGAGACAAGTGGGCGCCCAACTGCGGCACGGTAGAAGACGATGGCGACGCTGTCCTCAACCCGCTGTGCAG