Description :
From Genome Similarity Track
Location :
Scaffold_2:101954- 104236
Sequence
2282 bases(100 bases per row)
GTAGTCGATCGCGTTCTCGATCGCCGCGAGGTCGCTCGCGGCCGCGTTTGACTCGAGGCTGGAGTCGTAGTCGTGGACGACATCAGGAACGTCACGAAGC
AAGTTGGCGCGAGGCTCCCACGTATCATCAGCAGGTTGAAACCCGATCCATCGTACCTTATACTTCCGCGCGGCGGGAGCCGCGTGTTGAGCCGACGACT
TGGTCGAGTGACGCACGCGGGGATGATCTTCGTGATCAACAATACGGTCCACAATCCAGCACGTATCTCCATTCGAGTAAACGATGGGCGGAGGACCGTC
GCGGTGGAATTCGACGCGACCTGGTTGACCAGGACGACGTTGATCAGGCGCTCAACACTTCTCGGGACGCACAGGAGGAGGTCGAGCGGGCGGCTGTGAG
CTCTCGGAACGCCGAGGCGACGGCGAGTAGTCTGCGGCAGTGAGATCGTGAACTCTTGCAGCGACTGCGTAGTCTGGAGGCGCAGGTGTTTGGCGGACCG
AGGGGTGGAGCTCTTCCGCGCGAGCGGGGAACTGGGACAGATGGGACGCTGGCTCGACAGGCTCATCGCGAGGGCCGCTCAACGCATGCTCCTGCTCCGC
CTCCGGGATCATCGCGGGAAGATACTTCTTAAGACGCCCGACGTAGAACGTCGGGTGTAGTCGTAGCGACGTAGGAATGTCTAGCGTGTAGGCATCACCC
ATAACTCGTAGTACTTTGAATGGCCCAATGTAGCGCGGCGCGAGTTTGCTCGCGCCTAGGTTCATAATAGCAGAGGTACGAATTCCATCCGTTGAGAGTA
ATACACGCTCACCAATCTTGAATGCACTTGTGTTCTTGCGGCCACGTTTGTCAGCGTTTTCCTTCTGCTTGTCAACCGCGAGTTGTAGCGCGTCACGGAC
GAATCGGGTAACCGATTGGCGATGAAGGACAAAGTCGGATACCGCTGCCTTGTCAGCGGGTCGCGCTGGGGTTTCGGCGCGTAGTTAGCCACAGTCGAGT
GTGGCTGTGCTGGAGCGATCAGCGTTCGGTGTGTCCAGTCAACTAACGGCGACGACGTGGATTGCGCGGGTGCGAGGATCTTCTTCGACTGTAAACGCGT
CACCGCGTTGATGTCTACTGCAGGAATAGCTGAACTCGTAGACGGCAGAACCGTTGTCTCACCGGAAACCGGTGGTTGAACCAGTATCGGAACCGGTTGG
GCAGGGTTATCACATTCCTCCCCCTCCAGAGTGAAGCCATCAGTCGCCGTGGGTTGGCCCACAGCAAGTTGTGCGGGGACACGCGGATGACGCGCGTTGT
TGACGAAAAACGGAGTCAATCCCGTCGACGCGTGCTCGGCATTGTTGAGCGCAAACTCCGCAAGAGGCAGGAAGGAACCTTAGTTCTCGAAGGACGGGGC
ATAACTGCGCAGAACATCTTCTAGCACGCGGTTGACGCGTTCCGTTTGCCCGTCCGTCTCCGGGTGCGCCGCCGTCGATATGAGGAGTTTGGTGCCCAGG
AGGTCGAAGAGTTTCGTCCAGAACGCCGATGTGAATCGGGGATCGCGGTCAGAGACGATTGATTCAGGAAGCCCGTGATGTCGGAAGACAGCGTCGACGA
AGAGCACCGCGGTATCGCCCGCGGTGATTGAGACCTGAATCGGAACGAGATGGCACATCTTGCTAAAGCGATCCACGAAGACCAGAACACCAGTACGATC
GTCAGTGTCGGGTGGGAGACCGAATATGAAGTCCATTGACACAGAGCGCCACGCCTCTGTCGCCTGAGGGAGAGAACGCAGCGGAGCTTGCGATGACGGT
GACGGCTTAACGCGTTGACAAGTTTCGCAGGAGCGGACCCACTTGCGCACCCACTTGTATAGGTGAGGCCAGTAGAAGTCGCGGTATACCGCTGCGAAAG
TCTTCTCACGGCCCAAGTGGCCACACACTGGAGCGTCATGGAATTCGTGTATAATTCTTGCGCGTAGATCGGGGTCGTTGGGGACAACGACGCGAGGAGC
ATCGAATCGATCGATACTGTACATCAGTAGATCACCGTCAAGTTGGTATCTGTGAATCTGGTCGCGCGTGGAGCGGCTCAGTGTCTTTAGCGTGGCATCA
CTTGGTGTGCGAAGGTGTTCCAGGATACCGGCATATATCGAGTCATCTCGATACGCGGCAGAGATCTCTTCCCGCAGGGGAAGTATTGGAGATACCGCCG
TCATCAGGTTCACACCTGCAGCCACACATGTGGCGCAGTCCAATTCGTCGTCGTCCGCGTCTTCAAGTGCCTGACGACCCAC