Description :
From Genome Similarity Track
Location :
Scaffold_57:101946- 105581
Transcript NameFunction/comments
Phyca_LT1534510266PHD zinc finger-containing protein

Sequence
3635 bases(100 bases per row)
cgataagagggaaaagaaggacaagaagaagaagaaaaaaaagaagaagaaagacaaacacaagagggagagcttggcctctcaagctgacgatgaacag
gaacatgacgagagcagtagtaaaaagcggaagcggagcaagagagaatcactggatacagacgagaactcgaattaccagcgcagcgataagggcagcc
cgtcgactccttcgacccgcagattggccttagatgttccgccctctgatgtaggagctactcgctcgccgaccgcgtcattgacgttattcgaaagccc
agcgactgccaccaagcgaatacaacagcgtttggaagaggcattggggaagagtgacgatgacgattctgacggctcaacagtgagctcttcgttgaaa
aagaaacgctctagcaaccagatcactgacggacaggagccaagctcaattgaacacactactggtgcaagaaccggtgaggttatggaacgccctcaat
ctccggtcccatcttctccagtacctgacagtccttccggcgataaggactcagtagaaggtcggtcgtctgcagaagaggatacgtatatgaaggtcga
gcgcaaacggagtcgtgaggatggaattgatcaaccgagatccattgagagcgcgctgaaattggagatcccgaagtccccttccagcattttaatcccg
gcggctgaaggtaacttggtacttaaacatgtccctagcgagggagaagaggagtacgacgaaggtggagctgggtcagtaacgcctgcagatgccacac
ctagaacacctagaggtggccgaggtcctgggaagaaaaaaaggaagaacaaggcaaaacgagcgctcaaaagggagacaagcgaggaggaggaagatga
aggcaacgaagccaagtgggtgcagtgcgatagttgcaagaagtggcggacggtgccgagagattttaatctggatgcgatgcccaagcactggtactgc
aatatgaacacgtgggacgatcgtttcgcttcgtgttccgtcgctgaagaagtgttgaaggcaaacccgtcgcctctggctgaaaagaggaggtacaagc
ttaaggcgaaatccaaatccgcttccagtacaggtgacgatggctactcttcttctggttctggcacgttgaaaagggcaggaggatctctaaaggggtc
tataacagacatggcttcttggaagagaaaagctcgcgatcgaagaaggacaaaggcttgaagaagaggaagatcacaaagcatctcaaggagaagtatc
gagaagtcaaatgggtgcaatgcgagagtacacaatgcggcaagtggcgcgttgtgccagcctccattaacttcgatcggctacctgcggtgtggtactg
ccaccttaacacatgggccccggagctagcgaaatgcactgctcccaatcctcctgaagtcgatgcgttcctgtcaaagcaggccaagaaggaaggccgc
ccttccaagaaagctcgggcttcctcatctagtggggacgtgataccgacagcttcggtgccagttgcctcgagtgggatgactccaacgtcttcagcta
acgacctggcttctcttggcaaagcaaattcagggaaacacgggaaaggggccaagtcaacggcttctgggacggggaacggctcaactagcaatgcgga
cggagttaacagctcgaacccaagtagtggtcattctgctaaaggaaggggaggacgaggaagtgggaacgccactggcattaagaagacggtgctggag
tgggcacagtgcgagaagtgcaacaagtggcgcaagctgccgcagcacatcaaatcctcaactctacctgataaatggtactgctcgatgaaccactggg
acccgtctcacgccaagtgcagtgttgctgaggaagcagaccaagaaccccttccattgccgcctcaccctggttcgcagtggcacaaagggggacacaa
gggtcagcgtacaagacgaggcaagctcagctactcggagttactgtacggaagtacaggacagctccggaaagcgtatacggccgagtcttcgaccttg
tcgttcgattacgaaggcatcacgtatcaccgcgacgaccagtacaaacacagcagcatgtacgtgtctccagccgcgatggcagccgctgctacaatgg
ctggatggactggcagcgaccgagtggaccgggagacgaactgtaaggaaggagtagtcaaagtggacgctctgggagctgctactccggcccaggcgag
tgtagatgaagttgcagcgttagtgctggagaagatggacctacgtcgtcgtcgcagtatttccgagctctttgatgccgtcaacgctgtgcgagggtcc
gaggcagcagcgaatggccttgcgtctctggcagtggtgactgccgccttagggcagctggagcaccgcggtttggtggagaaagtggcagagttctcgg
aaggtgaagacgaaccggctcagaagcgaagaagaacggactcgctcttcaatggcgcgttctctatgcctactcactaccggaaggtgcccacgagacc
gctcaaggcgtctaaatgctggaagtttggggccaacgttgtgactctctcgccagttcaggactcttaaagttcgcgtgaaggactaactgaaatcgaa
tgtaagtgcattgcctcctcgctctggtctgatctgcagtttgtcttctttgtctgcgatgaccaggagatcacatacaatgagcggcttaactggtctc
aaagacctgttgttagattctcaggagaagtggcgatgttgagaggacggaatctcctgtcaagcgggaaaaatggttttaagctgagttcaaggccgac
agacctaaattctgctcagacgcctgcttgagtgcaaaacagaatggttaaatgacgagagaatgtgtgtctcacttcaacttcagcaggagtgatgatc
attttgaactaatgtcaaatctgtcaaatctagacggccagattgttcatttggccgggcgatctggacggagtgatctagcccggaaatctgtacggct
agatgctgcgggaatcaattggacagccgtgaaattcttacccctcgactgcaaaagaaaactgatcattgatgctgtctctagaaccaccaccttttgg
cgctctcaggttcacccagagactccacccattcaactacgtgttgctgtcgcttaaacctcgccatatccaccgtgaactcatttaagctcttgtactg
agtagagtacatcatttgacggccagtctggcaaaagcgacaaggccagtggtggtagcacgaacaacgtcgcttatctccttcatggtgaaataaccac
ttcaccacatctaaatggccattttgcgctgcaaactcgattgcgtgcgttgtgtacccctccgttctgttttcatacagccacatcaccatatctaagc
gacccgaactcgcccaattgtcgattgcactcggtgagcacaacctggcattatcttgattttcatgcagccacttaatcacatcgaaatccgtcacgtc
atccattgtataaggtaagcacccctcgttagtgt