Description :
From Genome Similarity Track
Location :
Scaffold_27:101889- 120179
Transcript NameFunction/comments
Phyca_LT153459719PREDICTED: methylmalonate-semialdehyde dehydrogenase
Phyca_LT1534114819Hypothetical protein
Phyca_LT1534114901Hypothetical protein
Phyca_LT1534114882Hypothetical protein
Phyca_LT153417341Hypothetical protein
Phyca_LT153480773PREDICTED: uncharacterized protein LOC101731501

Sequence
18290 bases(100 bases per row)
ccaattcacgcaccctagtatcaagatggtactttcgactcgtgtcaacagctgacaccatctcgatcatgtgaggttgtagttcgcgcgttgtatacgt
tgtcttgcgatcattagcaatgcgatactgcttttccaccagttcataggcgtgctgactaacctgttttgatagcttcgtcaactcagcatcagctcca
gcgtaacgcatgtgtccaacgtctgtcattttcttcgcatactccatctccgcaatagactgcaagaactgcagagtatcaatgcactcatcgagcgcca
ccgtagacttcagcacgtccttcaagtgaccccatgccgcctccaacctaagtcgttatacaaatcaacatttagcaattagaacttgagacagaacaaa
aacgcctcagtacctgttgtttgtcgtgtttcccaaatgagggacgtctacacgaccaaatccactccacatgtgtctgcaattgtgccagttctcgtgg
aagtacttcagaaatgggtgtgttgagccctctggaatatcttcgtcgagtgtaatttgctttccgtcagccacgtagtacagatatctacgattcgttt
catactcaagctccgtcttggcgttcaccatcatatgcacggcgccctcaaccttatcccgatcttcgatattatactccctctttgccatttctccccg
aagatacttcaccacatgaaagacacagagcagaattcttgctgctggaaaagcctcttgcagaagcgcaatctctccaaagtctttggccacgataatc
actcgaacttggtcccaggttgagttaaatgatttgaacgattttactgcatcccccaaacaatcagcactttcgttctccatgagtgcatactgcacgt
attgcccctgtacacaatcaatcacaaagaagtacacaattgtagcgatggcacacaatcacattaaagtcacatagaggcacacaaatgtaatgggaca
cacgggcacagtagagtcacacaaaccaacaccgaggtacaattagagtcacacaacagccactaccaccaaaagagttcttacatggccgaatacatcg
tgaatcatgaaactgaagagcttgtatcgagcatcgttggtgttgtgagtggcgtccaccatcaacacctctgggaacgcctcaaagaatcttcgcatct
ggtgggtctgaaaagtgatcgtctgtgctagcttctcgtcatccacgtatatggtcgccgtattaccctttcgagggcagaaatcgcgcaaaccagactc
cagtcttgcctcgacggttgtagctccacgccgcgcctctttcagcttcgccacaagattgtgcacatcacgcagggtaacgtgctttcctaataacgag
gcattagaaccaaaacaagcatactaacatagatacaatcatgtagcgtaccagtttgcttcctcagatactgcagaatcagctttttcttcgccccagc
agcttgaagctcatccacgaagtcaatcacgtcttcgtctgcaacgcgtcgatttgaggggtgatttccataagatcctgagcttagtgagtggttgtgc
gatgtcgcctggtgcgtaaccttcacgtggaaaccctgagtagcattccacattacgacgacagtcatctgcgcttgacatccggtagacttcacgaagt
aattatgcctcttgcccttcgaacggctgggccttgaccaactatgcgtgcacaccaacattcaatagtacttgtcgaaagagtctggtacaatggtctg
cggggtgtccttaccacggtctcggagatccgcgttcctcgccttggcgcttgtagaggtcctcttcttgaatatctggtgggttttgtgctgatatgcg
tctaaatactcgaaaaacgcaccccaactcccgaacgtctcctcatccatacgtggggcgcgggtgacagcggcggcagatgtggggacgtgaagttcag
gcgactttacttctgtgggctcgatatcgggctcagaggccgacgcgacgctcgccatactggtgctttccgtcgtgcaggagttttagcagattctgac
atgaaaggcccagaatgagttgggaggggtgaaagggggggagggggtgtttttctacttttgatgctgactgatttgtcgggattttatccgtcaggaa
ttttttttcttaccgacatttactgtgtgactttatccagttccgcatctaggctgtccccagaggcaccatttacatagcatccaaaatacttaattgc
gaccaacaaatgaacctctgcgggcgctttttttatcttgcggacaggactttcgaaaacagaattcgcctgtagcaggcctacggtagcaaagaataca
ggccttgatactcaaaaatttgacaggaacttgtccgatggcaagtcgtagaggtagtgaggcacttgtgatggtcgaaggtctcgacggtccctaggaa
tggtgtagcgagacacctctaccacgtagggtagctccagtaacatgtcggtttcgtcgtcgtaatcactggcttcttgtaggcgagtacgtgccgacgc
accgagcttgatcaactgcggctctgagagtgctaagctggtggtaatttctcgatgaagtcgttcacggtttgagattcatgccatggtgttaaaagcg
ttttgaaaatgctgggatgtgtgcctgacttctggagatcagaactgaatggggttgtcagagttaacgatcagtcattggttaattttatgttctgaaa
aaccttctgaatattacctttgacaaccactatcagtggttctcagagttataaggctttgcctgatctgtaatgtcggattatgtttccttggcgcgcc
tgaccgcctatatgagatctgaacagaatctcaacggattcagcattatcggaccctggttcgatgatgtctccgctgcgtttcctgagaatgacgtttg
ctgcatttatacaatgcgccgttcctccggttgaggagtctttggcaactggtccacacgattaagagctgcggtctcggaagaagaaaaccaacaccat
cgatcccaatagtaggtctaggtagtctccgtttccactcgttcgtttccgttgcagtgacgtgtacatttcgcgcaacatgggtgtgctgatgggctgt
ctacggtcgacacagctgttggttctcttataccccttgtcaataagctcaaattccgggttcttataattgagtagcgcattgtgcacactcttatggg
cgacagcgaccgctgccatattgctgtcgaaggtttgagactcgttccctcgtttaagttggttatgcccttcgagggcgcatattgtgcgttctattcg
aaatttccgcgcgcgtgtgagagacaccccccagccacacgccccacaaatcgtgtaaacctggattacagaataaacctttggttgcaccaccaatcac
tctcactctctctttgacgaagacccgcactgaagcatggcgtcggcaccactacgttccccactccggcgtggccatgcacgcatatcgccgtacgttg
tggccagccactcaccacgagacggagcctctctctctcatctggatcgctcaccaagcgaagaagggcgccctccagcgagtcgaacgggcgcccagac
tactctacctgcctcaacactcgctcctgctgagttcaggaccggtgtgcctccctccgagtttgtcgctgctgcttctcgtggaacgttggagaatgca
tcgacttcagagcgcacttatacagcttctactggttcttgcgcgacacttcctgctcctgagattctgtcggtcatgttgaagccagtgcgactttatc
cgctcctgaacgcgatgctgcggctgcagtctgacccatggaagcaggagaaactgtatcagtttatgaagcggctaatggagctcctggtgatcttttc
caactacttcttcggcccattataaagatatcaattaaccagcgggatacgtccggcgaggtacaacgtgataaagtgtttactggacgttcttttgaca
gcattatggaggctgtttgggagaagttttctcctaacataaagaagcaagccgtcaagaccgatggtatttggagcgtggaggaccctcaattcttgga
gtgggcaaagttgctgcagttcaaggtaaaaaaaatgcattgtcgactctacaaagtcagtacaagcatggaaccaatcgttgcaaacaaaggaactact
gtgactctcatggtctacgagtacggtatggtcattgcaactgctaaagaccgagatgaatttatgaaggcatgcgtcctagcagaggagacggatcgtg
caggtgcaacagcagaaagttatctgcgagaagtggttgagccgcttcgacagaagtgggtaaattcttttcaggcctcgtcggttgtctggcgtatgtg
ggtgaaccacgtgacacgaaatcttaatcgctcaacttggaatgctagtattgccaacccaccgccaagctacataacaaaccttctcggtccagcggag
tcacgccttgaaaagcacttaaatggtgtagctcaatcttccagtgtggcgctggactgtgagagagcctctattggtgactgtcagcagctccgccgct
accttaaacccgctgtacgttacgttgacgatcaagaacagcgattaatagcacgtttagctatcattgaagcattattcgcgatctcgtgcctccgtat
ccaagcacgatcatcgacccgatgcctctgattgagacacagagcacgccgagtaagaaccactatactcaagcaagttttctattatctcgcaagtgtg
agagctaaaacgtatcgtactttgttaaagtttacgattcctcgtctagcgtagtaaaatccaattcatcatctctggccgtcattgggttgagttctgg
ttgcgtccgcttttcaatcgaaagaggcccaacaggatcaaagtaacattgaatattccatccacagtgctgaaataccttgctgagattgtatcgtcgg
aaccggcgaaatgtctggacaacaaaaagcataagatcacgcccactagattcgaggtagtgtcgctggaatgagcgcttaacgtaaccaaacagaaccc
tatcgggttgaaaaaagggcgaaaagccggaaggaaaatggacacaacaccaacactgcgaaggtagtggactacctctggatgcctgtgaatagtagcg
ccatccacgatccagactgaatttcgaccaggatattgacgaaccggtccactatagcaatgtacgaaatcttgacagcattttgtgaactccactcggt
caaatgtgctctctgtgctaaagtagtcaagaaccccattaacgccaataaacgccaggattgaaacccgtggctttcgctcaaagtcaccccgaatagc
aaccttctccccacgaatagcgtaacctcgcttgcgtatcatgcctctgttatcgaagctgacctcgtccaggaaaacattgttttggtggctccagtct
acgtaacttagtccctccacgaagcgaaacacgtcacgttccttgatgtacatcgcgcgtcgctccaacaccttccaggtgaggccatacgcgtgtagta
ttctccagactgacgtttttgagatgtcaacagaatgagcccttttgaaagcatcttggacttcgtcgagatacgcaagaggatgctcctggtagtaatt
aaacaaccattgacgctgctgttgtgtgtattgtctcctggtgactgtgttcactcgctgaaatacccccgtagtttcgtacaccttaatccaggtacgg
attgcgcgctccgacttgttgaagatgtacgcaagatgttttttggaataatgaagcttgtagtaagcatagcggcaatggtacacagtgttggcgtggg
tgtgctgccgtgtagcagcttcctccatggttgttcgcgcattaccagcacttcaacatgcagccagcgccttattggatatatttagaccaataatcag
cgttgtattcagattttggaccaatcatagcgtcttgttgccttgtcgcccgattgccacctttcccgaacacgcacacctgcggcaaatttgaacggaa
ttgacaataggcctgcaaagaaaccggcaatccgtgcctgtctctcttacatgagttcgtcgatccaaatgggaaaaccgaaatcttgaaagaattggac
ccagtgctggaacttcttggagtaggtttgtagagtttaggtgttgatgcttgtccgcttgaggttttctgttgtggcagcgatccgttcgattctgtct
gtaagcacgcatgcatttatgagtgagtaggttcgtgtacgccacacgagcatgtctcgccgatcctccccaagactttcgtcaccgttgacctgagtcg
cctgttggcttgcgctaatgccaatgatcttaggtgttgttgcccatctggggtcgaactgtacatggattctagaagcctggcctcccacgttgtttgc
acgtgcaatcagatgtgaagtgatgatggtttgccagtgtttactggcaccaaagacatcaccgctttgagtatcgtctctgtgacggtcgtttattttt
atctgaggaagggtagctcgcatcggccgtcgtggcgtcagtccatgaacggtgaggccggaagtatggtgcacgagcaccaagccgtcactttccggta
tttcggtattgaatatagtcatcggggatcctgcggaatcgttctggaagacgagagtttccacaattccaggtcgtgccgtaacgcgttagtcattggg
gtgcctgggctctttatccgctcggtgttacattgtattcctattagacgttgcataaatggttttgcgattgaaatgaatgcgccgcgcgaagaagtac
acccataggctattcaggtgcgctcgtgtgattaacctcctctcgagtgtctccgcgacaactcgttggactttgtcgattttcctctgcggaatggata
cggtaaggtcggctatgtcccaatctatacctaaggcatgtatatgcgaagtccatgttgtaaacttcccttcgtgccatctggcagagccgaacacgag
tttgactacatctctcaggcgacgctcggcttgaagaagcctaccccctatatcggtttcaatgatgacaatgtcatctacccattgatagatccagaat
ggttccgggaatcctagaacgtatgatgaccctgtgcgttggtagtgtcagaaggctttaccgaatactgcaaagtagcctggtgacgcagtccaaccaa
acacggcggttcctgaaaagattcccgtgcgcgatcgaggaactgaacccccaaatacgagaatgtacgggcacatgcaggaatgcttcagcaatgtctg
ctccgagagcgtagatggtagagtcagactattgcaggtgcaattgtagaactctttttcgcgatggaagagttcggatcccaccgtgcgtctggcgttc
aatcggtattggttgcatcgttaattgaagctcccggagctgataagtcatggatgatgcgtccatcatccgaaatcggaacgtccttcttggggacgag
tgcgaaggcacttgagtgaaatgcaggtatcttctctaataccgaaatatttgcgagtatacactcggtagtattcagtgacgagtcgatgcgtaacgat
agcagacccattttcagcacttagtaatttcgggggtactggtcgtataccaacccggtctgacggaccattccaatgcggaatgatacacttgcgctga
tgtcttacagagtagcctcagattggagtaagttggcaagtgtcgccgatacaggtgcggtcacagggccttgtttggactttggtcccgaggtgtctga
ccccggaagatttctaatacaccttcgattcccacgctcggaatgcgaataacagcagtcaggaatggaacacttctggaatgtgagctgtggtgtagag
ggagtcagaaatatccgattcacagggaaaggaattatcgacaagatttcagggcggtttccgcacagttgcttttatcgcatgcttgaatgagcccgac
aacaaattattaatttctacagtacaatctgttgtgagtgttgcttgaatgaaccctagacctggatgagtcacaacgaaaaccgtttatttatacttac
aggatatacattattataatcgaagagcatttttagttataatcaaagagcattgttagtgcaaattctacttgaacctgatccgattcaacgggggttt
aattatgcgcgcattggtacgatataaataccgtatgtggtacacatcacgtgagaatgattcttagacggaattcgtcggacattcgtcggactactgg
attctgtatgatatatcatagtttatgcaaattgtagggacaatctttgctaacatcactacgtctcgctacgccttttcttcgcttgtcgaaggagttt
cccaatggtagaccagctgagctgccctcgacgccttatacgggattgcccggttgtggactcaacagcaacactatctacgcatgccaggtacacatta
atggcatcttcgatactttgacagtgcgtacacattaatggcaccttcgatactttgacagtgcagaagcagattctttgatgtagcatcgcaccaattc
cgttccccacgtctttagctagcttgtttttgagtctttgcagctctgactccagggttttagccattgtaaatccgaaatcgcggtagagattgaacaa
tgctgccctatgagtattgagtgctgagtagctgagagggctgccatctctgtgttttaaagtcatctgccaagtgacaaaatcttgtgcgtggagttta
ttgatacgactgcctgcaatccgagtgcgtcgtggataggtnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntccttaacacacttgtagggatgacacctcgccaactcgcttgacgagagctcttggag
tgacttccatcctggtacgccactcgcgggaggacctaagtggacctctggagtgaggtagacagggtagttcactcaagtagccggtagacacatactt
aggccagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnac
ttctcgacgcacagacttcagggccttcttcaccacaacgcggggagcagctcgctccaagtgaccactgccacttccaaaacgccacccatgggtaacc
acaccgaccactacgatcactccagtaccggtagtcaaccaactagtccactcaagcagtaagttcaccaaattcagcagtagtagtaccactcccagtc
cagtagttccaaaagtcacgaactccagtagaacgaacagtgtcatgggcacgtgaatcaccagtgacagtatgagtagcacaaaccagcacactccttt
gactacagcgaccagtcgttgccaaacagtagcccacgcttcccaagtagcacgagtgtaggccaagtaggagtaaccagaccgtacacttaggtcgggt
aggtattcaccgaaggtaaccagtagagcagtccaccaactcctcagcatcagaccatactgtccgtactcagtctctccttcttccaatacttgcactg
gtaccgcaaagaacgcgttccacagcgcgaaagcgtacgcagtaccactcagttgtccgagctcgggatcacgaagcacttcttggtagcgggtcacgaa
gttgacgctcatagtcgaattcagggacacaactaaccacacttgagtcaccagagaccaagccactccacggacagaggaagtgagtacccacagcacg
acagtcactaggtaggcggggagtaactcccaacggaggtactcagtccaaacaacagtgagcaggtcggtcatggggagtaggagtaagcagagtatag
cgtcgacggtaggtagatggcaaggtagactcacgtcggcaagaagcagggtagtcggtagttgggtggacactcactcagcaatagtagtagcttgagc
gaaagctgtcggaaacgaaagtggacacttgccacgcggcaccactccgagtcgtaccgaaagatagacttctactccagtagagttcgccacggcagaa
tttccaaacaaacggtagaaagaattcacannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngagactgactactgcccgcacgtcatg
accgacagcaccccacctactctccttcagggtgtcgagggcatttatcgtcgggcctacaacatgggcaagacttgtcaagcactcgcttatccgtggg
aggggtcgaaggtctggtatgatcccgtcgagaatgagttactccatgtggcgcactggaggttctggatggccaaccgggttcgcttctttgagtggca
gttgaacatgccctacaggagtagttccgctcggagtcagcgtcgtcgacagactgctctggcccgcaccgctcgcctcnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnntacgacggaccaacgattcagaatctctccagtctgtttactcaggatttcgaagcgtacaaggctcgcgtgaagggtgcgctcaagcc
gctccacttggatcaaggaggcttcacctcgatcaccgagttactggtaactacgaacgctttggatccagaccagaaggttgactgtcgactctcggac
gaagcactcgcactagtccgtcgggacgagcagtcgaaggacgaaccgggagcacagtggtgggtcggtgacctcactgaaggagtgtgggcccgactgg
ttaacaatcgctggaccacccaagtcgagttcaagttgcaggagaagaaggacaagaacgagtacgacctgcctaagatcccgccacttcgagtcaacga
ggaaggtcatcccgggtactctccgatcaagcatcgagatggcaccttcatggctctgcaagcagctcccctggagaagcccatcgacgaaagggactcc
gacagcttcgaaccggatagcagcgatgaagacgaggttgaagtgatcgagacgaaagcacccgcgccaaagttcgcgccttcagggtaagtagcaggtg
caccccagggctttcagagtaggtagttcagtctactcacaggatagctaacttcataattccatatctgccttagtcttcagttcgcaccagcatttta
gcttcgaagtcgttcttgaaattcatcaagttaattacagtagcgcgtacggtccgcagtagttcccagtaagaagtcgttgttttcaatagagtggtcg
caggtatagtcacttgtacgcaggcacaagtggtcccaaatcacgatatcgcagagtcaaaagtagttaccagacaccaaaagttcaaaatcagcacagt
ccatcttgaaagtagccgcaatttcccaagtagtaagtagtcaccacacagtcgctagtcacagtaatatgtaggaacagtcaccaagctgttcacagta
gttcaggaaaaatgtaaaaggagtgctccccggagcactcgtcggactcactagtccgactcgccaaaatgtaaaaatgtaaaagagtgttctacccgaa
cactcactccaaaaatgtagtcaaaagtaaaagagtgttccaccgaacactcactccacggggcttcgagttaggagagtcgctcctctcaaaacacatc
ccgcaatatcggtttagaaaagtagttcgtcctcgtcgaccgtagcgttagcatcagccagacgagcacttcgtcgtaactccgggagcccctgctcctt
acgacgagcattctcgaaagcagtaatcagcacgtcaaaatcgggtttcagtgaagacgcaggcaaccaactcgtctcataggtggccagtagcaccaga
tactgcagctcaccagccttctttcgtctcgcaagtatatccacaacaggtaagctcacacctgaaaaagcagtttcttcagatccaataactagccgct
ccacatagctagtggaaggcaagtcctcctcgaccaggggtccatcgtcatcctcaccaggagtagactcaacaccctcaggaatttcggtggggaaggg
tcgactccatcgacccaagaaaggtttcagtcggttcacgttgatagtgacnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnaacctgcccttggagtcgctgctcatgacgaccttgcgccttgagtagctgcctctcgaccaagcggcgagtgtc
tcttagagacaagtagagtctacgcctgtaagcagctacctcattgctcttccactgagcagtggtgttcagaaatgccaagtctagaggtaacactggg
tcacggccatacaaactaaagaagggtgagtcgcctagtgcttcgtggtaggaagtacggtaggcgaacagtactctcgggagatacaagtcccagtcgt
cctgcgactcactcacatacatgcgcagcatacccaacagtgtaccgttaaaccgttcgaccagtccttgggtctgtgggtggtaggctgccccaaacag
cttcttaataccgagtgtctcataaggtgatcgagccaactccgagatgaagtttgacccttggtcactgagtagcttctcaggcactccatggcgagag
atcacctcgtccaccatcacttccacaaaagtcactgagtctagacgcttgacagcgaacgcttccacccaccgggtgaagtagtcggcgaacaccaaga
tgaacttgttacctcggggtgtagtcactagtggaccaacagcgtccactaccagtagagagaactgtcgcgaagtcggtgaaacttttaccgcggtgca
ggggggggcgtacagtgaaccaacgggcgacagtactgagggttctcagtagtcgccggttgtggcgtgtgataccttgtgtatcctcgttggttcgttg
tctgaggaatatgacacctcccgggtcaagtgttgtggggtgaagatggtggagctccgtgcgaggccagcggcgaagacgttcgaagccttagcggggt
ccttctggagtcggaagccctgagaatcacaagtgatcctcagagtgtgtagtcaaagaaaacaatgaagaagtccaataaccaggtacttgaatatcgc
aaattcagcacctggaggcttagacttagaagataaccaacaattaacagagttcaatacaaatatacaatatacacaaccgtcacttattctttcctgg
cccttggacggtgggctagtacttccaggtcaactgggtatgtgtttcagacccctggtctgtctgaaaacccgttcctttcgcgcaccaccctctaata
tatagagggaaataaaccaatacaatcggttataaaaacagtcaatcaagcgtcctgagagcgactgtctacctaaacagaacctgtccaaacgagcaat
atgaaatgggctcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnncttctcagacttggaggcttgatcttcagacatgtagcttaattcccaggggtgtagagctctgctcgatacacatgaagtcttgag
cgtcaactggaacatccttgggcttattagggatgcttgggacttggggtaatcatcgtgtgagaggtctgggatctttgtcggtcatcactctggcatt
ggtcttcagagtggcagttcttagacttctggttctcagactcagaagcttgatcctcagacttgagacgatgattccaagggtgtagagcttcactgct
caatacacacatagtcctcaggggtgtcttgggtaggcgacgtacagcacgggacacttgggcacttcgggcctcttgggtcttgtgggtcttggttggg
atccttgaaccgtcaatcgtcgctcatgggtgtaacgggacgaggtctctcagggatacattcaacctgagagactttccgccagaacttaggcactcgt
cgtcggggaaagtccggtggttggactgagtgctagtctgcccagacttgtgcacagtcctgggtagcacttccaacccgttgggcccctttacaaacag
gcgaaggatgaatccacaaaccaacatattactccacaggaccggtacatgccatacgcacgcaaccgcgtctcagcccccagtatatccatacacacac
acatcgtggagagacagcagctcttcgcttgaaaaccggagattgcgatatcacagaacggtccagtgagttcctgtataggcatcttctgcatcagtcc
attcctccacggacggtagcccttgccacttccgcacacagtacactcccggacatactcggcaacgtccttcttccacccatgccagtaggcgtgcttg
cgcaccttgtctagcgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnngtgataggtataactggcacttccagtgaacgagcgggaccagctcgagctttcaagtggactcgacgcatcagtatcccgttc
ttcacagtgtagtgtggagccaaggacaacaccttcgctcgcagttgagcgtctagtgctagggcaccactctccaagaaggcaatcatagcaagtatcc
agggggtccgcttctgttcttcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagggggtcgctccccaacctgaactgggttgtcactaccagga
gtagtagtagcctcaccagtcgtctccccgaccgggactagagtttctacctcctcatttgcttcgttgagtagatccgccatagtgacggcactcactg
tcactgagtgtaaccttgaaagaccgtcgacatggcccatagaggtaccaggtcggtggaacaccttgaaccggagctgggacnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncaggctccaacggctagcttcgaggagtcgacgtacaacttgaaccccttatt
aaagtcagggtagaccaaaatagggggctccaccaacttcctcttcaactgtctgaaagcagactcacagtcagcgctccaagtgaacggtacaccctta
gctttcaacttctcgatgggagccgagatagcagcataaccaggtatgtatctccggaagtagctagtcaaccccaaaaaggctcgaacacctcggaggt
cactaggtcgctcgacattcatcaccgccttcaccttctcaggattgggaagtataccggagggtgtgactatgtgtcctaggaaggccacttggtctcg
accccacttgcacttcttcatcttgagtttgaatccagccgttctgaagcgatccaacacctgacgaagtctcaccaagtgagtcggaaagtcctcactg
aacactacacagtcatctaggtagaccaagcaggtccgccacttcaagtcaactaacactccttccatgagtcgctcaaatgcaggcactgcattgcaca
gtccaaacggcataaccagccactcaaacagaccgtacttgcaagtgaaagcagtcttccccacactacccttcgccatgggcacgttccagtaacctga
ggcgatatccatagtggagaacaacttagcgtttcccagtacatccaagatatcatctatgaggggcatcgggtaacagtccttcacagtcactgcgttc
agtctacggtagtcgatgcagaacctgattccaccgtcaggcttcctgatcatcagcactgggctagcccaggggctactcgatggttggattaacccca
agtctaagtactgctgcacttcagcttccatcacatcaccttcggccttggacactcggtagggtcgctgtttgataggcgggtggtcaccagtatcgat
ttcgaactcgagtaggtgtgtcctcccaggcttcatagacgactccacaaacatgtccttaaacgactcaagtgtctgtctgaacaactc