Description :
From Genome Similarity Track
Location :
Scaffold_63:101841- 108148
Transcript NameFunction/comments
Physo_138399hypothetical protein
Physo_138400hypothetical protein
Physo_157827GAS-3 homologue

Sequence
6307 bases(100 bases per row)
CCGATGGCGGTACTCTCGCCCCACTCTTTCCATGATGCCGGTTTGCCCTGCACGCAGTTGGTGATGGTCGTTGTCGCACCACTCACGCCAGCCGAGATGA
GGCCACCGGCGACGACAGACGCGGCCCCGAACGATGACGCTGCAACGACGGCGCCGGCCACCACGAGCGCGACCGACACCAAGCACTGCGCGATTGCGGA
GCCTGTGCCCCCCATCGCCAATGTCGAAATGTTTCTGCCGACCGTCCAGCACTCAAGTCCAGCGGGCGGAAGGCATCCGGCAGTGCACCTGGGTGCAGTG
GTTCACTGCTCATTCCCGAATCATCAGCAGAATGGGCACAACGGCGTCCGCACCCCAACGATCCGCCTCCGACTGGCGCTCCTCCTCCGAAGCGTCCGAT
GACTCGGAGCCGGAGGAGCTGCTGCCGCCGTTCGTGGGGAGCGTGCAGGACATGGTGGTCCTCGCCAAGAGCGAGCAGGACGGCGTGAGGCTCACGACGC
TGGTGCACCAGGCGGCCGAGCAGGAGCTCGACCTCTTCCACTACGCAGCGGCCGTGGGTGACCAGGACTTCTTCAGTATGATCATGGCGTTCCTGCCCAC
GCCCGTGTTCGCGCGCGAGATGCGGCGCCGCAACGCTAACGACCGACGGCCACTCGAGTGCTGCGAGCACATGCACCCGGCGCTGGCCTCGGCGCTCAAG
ACCTTCTTCATCAAGAACGGCGTGGATCTGGACGCCGACACCAACACTGCCGGGGCTGACAGAGCGCAAGTCGGACGGGCCGTCAAGCTGGATAAAATCG
TGGGGATGAACGAGCCTCGCGAACGCATCATGCAGGCCATTCGGCTGAGTGAAACAACGCCCGACGTGCCCGTCAAACCGCTGCTGCTTGAGGGCCCGCC
TGGTACGGGCAAGAGCTTTTTGGCGACGTGCATCGCCGCCGAACTGCAGCGCGAGGTCGTGGAGATCAAGACGCACGACGTGCTGAGCCACCGACTCGGT
GGAACCGAGTCCCAGGTCCGCGCGTACTTCGAGCGCGCTGCGCGGGTCAAGCCCTTGCCAGCGCTCGTGGTCATCAACGAGTTTGAAAGCTTGTGCCCGA
AGCTAAAGGACTCGAGCGAAAGCTGGCACTCGACGCTGCGTCAGTGCTTCCTCACGCTCTTCGACGACACCATCGACCCCGCGTCCAAGTTGTGCGGAGT
CCGCGTGGTCCTGACGACCAACTTCGTGGACAACGTCGACCCCGCAGCCTTGAGCCGCATGGAGCGCATCCACATTCCGCTGCCGTCCGCGTCCGGCCTC
AAACTGCTCTTCCCCAAGCTCTGTCGCGAGCGCGTGCCGCAACTCGGCGTCCAGCGCGTAGATTGGGACTCTGTTGCCTCTGTTGGTCACGAACTGCTGT
CTGTGCGTGGAGTTCAAGACGTGATCGCCAGTGTGGCGAGGAAGCAGCTTGCGTCTGACACCGCTGTGACCTCGAGCGACTTCGAGGCAGCAGTGTACGA
AGTAGTCGGCGACGTCCAGCCAGAACCACTCAAGCGCGCCGACAAGTTCATCCGCGTGGATATCCCGCCCAAACGCGTGCGGTCCGCCAACCTGGCGTCG
TGTGTCGCGCGATGCGGCTGGCGTTTTTCCAGCGCTCCGACTGCGGTATACCGACAGGTTTTCACGCTTGAAGAGGTCAATGCGACGTCGGCGTTTATCC
TCCGTGAGGTGGAGACAGAGAAGGTGTTTTCCGGTCGAGGCTGCTACCGCGCACTGGTTAACCCACGCGCCGACCAAAGCCAGTGGAAGCCTTTCGACAA
GTACGAGGTGCGAACACGCTGGTCGCGTTTGTAGGCTCCATTACTATGCTGACTCGCTCTTTGGCTTGGTAAACTTGCAGGTCTTCGTGCGGTGCGTTGC
CTCTGACGGTGATAAGATGGTGGCGGATGAAACGACCTCGATGTTCATCGAGTCGAGCGGGAACGCAGGCGTGCAGAGACTTGAGTGGACAAACACTGGA
GCCCACCTAGCAGTGTATGAACGCGGGGCGTCGTCGGCTACTGTGTCGGCATGCCTCGCACCGCGGATGAAGCTGTTTGAAGCGGACTGTGTTTTCGTTG
AGTCCAAAGCCAAAGCCGAGCTCACGAACGCAGACCCCAAGTCCGTCTTGGTGCTCCGCACCGACGACGACTCGTACCTTGTGGGCAGTGATGCTGTTCT
AGTGGTGGGAGGAGCGACTTTGGACACGGCGGATCGACTCGGCTACCGAGTCTTCCTGGCTGCAACAGCGCCAACTGAGCTCGTTCCACCGCACGTTGCC
GTCGCCTACCTTTCACCTCCTGACACACCGGAGAACGCGGGTTTGAAGCGGCTTGTGATCGGCCAAAAGAGATTCGTCGTGTGTTCAAACACGGCGACCA
CGGTCGGTTTGACTTTGCGCGCCAATAGCGTCTTCTACGCGGCGTTGGGCGCGGTCTACGTGCGCCAAACGCAGTTTAATGCCGCAGACATCGAGAATCT
GCGCCGGCTTGGCCACAAAGTGCTGGCAGTGCCTTCAGACGGCCCCACGTCAACTTGGAGCGGCCCTTCCATCGCCGACTGCGCTCGCGAGGCCAGTTTC
CTCGCCCTATTCGACGTGTACACACCGTGCACCGGTCCGAGTCAAGTGCTTGCGGCCGGAACGACTGTGATGCTCGACGTTGAGGTAAGCCATCGCAGTT
TGATCTATTGACGGTGATGCACAGCTAACTAACCCTTACATTGTCGGTCATTTTCCAGGCTCTGTCGCAACCGCTTTCGGCCGACAAGAAGTTTGTCATC
CTTCGGTACTACCCGTCGGCGCAACTGGTGCTTCAGGAGCTGTCGACGCACCACGGCGCAGTCATCAACGAGTCGGGTGCACGGGTGCGTGACAAGGGCT
ACAACGACGATGTGTTCCTCAAAGGATACCGCAAGGGCTGGTATGAGGACGTCTACTGGCGCACGGTGGGCGACCACCCGAATCGGTTCCTCTCCGGCGG
CGTGGACGGCAGCGATTACAAGTTTAACATCCGCAATGAACACGGCTTCGGCTTCGACAACCGCCGCATCATGGTCAAGTTACCGGGAGATGGCGTCGTT
TTCTGCCGAGGCGTGGACGGTGACGCAGGAAATCCCAAGATGGCGTGCGTACTGTTCAATGCCGACGGGTCCGTGCGGGATGCAGAGGGGTACAAGGGTC
TTCTTGGACGCTGGAGCGACATCGTCCAGTAAAAGGAGTTCTGGTCAGCATGAACGCAGCATATACGTATTGTTTTCGATCACATTCATGTACATTTTAA
CCATTACATGAGAACAGAGTGCGGCATCCATAGGAGCGCATTACAAGGAGCCTTCGCACGTGAATTAGGCCGATCTAATTGACGCTCTAGAAGAGCGACA
TGGCAGTGGCCGCCACCGTGGCCACCGACAGAACGAACGCCGCGGCAGACGCCGTGGCACTGGCGCCGCTGCTGCCCGTGGTGGCGTCCGTAATGGACGC
GCTGCTGCTCTCCTCGTTCGTGGGCGTTCGCTTCTCACCGACGGCGGTGCCCGTGGAGTGGTGCTCGTAGCTGTTGCCCTTGATGCCGTTGCAAACGGGC
TGCGTGATGGTGCACTCCAGAATGGGGACTGCAAACAATGCACAGGATTGATAGGGTGAGTTCTCAAGCCCAAAGCTGCGGTCACACGAGTAGGCGGAGA
TAGCTTACCCTTGGGCGTAGGCGGCAGCTCGCTCGAAATGTTCTTCGAGCACTCCAGGATAGCGGTGCGCGTCGGCGTGTAGCTGTCGTGCTCGACCGTG
GAGTTCTTCGTGGTCGTGTATGCCTTCTTCAGGTTGTCGTACTCCGGGTAGGGCGTGAAGACGCACTCGGTGAGCTCGTTGTCGCAGTCTTCCGGCATGA
AGTAGCCGACGCCGTACTTGCCTGCGTCGCCGGTCTTGGTCAGGGCTGAAGAAGGGTTACGAACACAGATTAATCGTAAGTAAAGAGTTGAATGAAGCAG
CATCAACGGAAGAGGACGCACTCTTGCTCTCGACCAGGTTGGCGATCTCCGTCGTGAACTCGAAGACGTTGCCGCCCACGATCTCGACCGTCATCTCCTT
CTCCTCGTTCATCCACTTGGCCTGCACACACCAATTCGTCAGCAACCGATCCTTATCAACATCTTCACAGTCCTTTGGCACTTACATCGAGGAACGAGCG
CTGGTTCTCGTAGCCCTCGACAGTGTTCTTGCCCTTGTTGCATCCGAACTCGCCGAACATGAGCGGGCGAGCGTAGCCGACCTCGGCGTACTCGGACATG
AGCTTCTTGAGACCCGTCGACTGCGAGTACTCCAGGTGCGTGGCGGGGTCGCACTCGACGTACGGGTTGAAGCCCATCCTGTTGTGGAGCACAAGAGACG
GTTATTAAGTGCAACCAGCTCTCTCTTTGCGGGGAGATCGTACCATTCGGCACGGGTGTTCTCGTCATCGTCAATGGGGCAGTCGTAGTACGAGATCCAC
TGCTCACGAGGAGGGATGTCGGCAATGTCCAGGCCGATCGGCACCTGACGCACGGAGCCCGAGCAGCTCGCAGCGTAACTGCGCGTGTCACGCAGGAAGG
CCTTGACACACGGAGCCGTGGTCGTGCCAGCGGCACCGTTCTTCACCTGGAGGTTGTTCTCGTTACCGACACTGAAACCGAGCGTGTTGTCGTACACCGC
GAAGGCGTTGTAGACCATCTGCGCGCGCGTGAACAGGTCGTCCGGGTAGCACTTGGGCGGCTTGAAGTCGAGCACCGAGCAGTTCTCGCACCTGCCAGCA
GAACACTGTTAGTAAATTTCAAGAAACTACAGCAGCACCTAAAGTCTATGTACTCACGGAGCGGTCATGCCCACGAGCACGTAGATGCCCGCATCGGAGC
ACGCGCACATGAACTTGTCATGGGACTTGCTGGGGTCCACCGAGTACAGTCGGATGGTGTTGACGCCGAGGTCCTTCATGACCTCGAGGTGGGGCTTCCA
CACGGCCTCGTGCTCGTCGGCGGCCCAGTCGTAGTTGCTCACGTCGGCCATCTCGCCGCTGTTGGGGCGCGGATAGTACGCCATACCCTTGATGCGGAAC
TCCATGCCGGTCTCCGAGTTGAAGAACTTGTTGCCCTTGGTGATAATGGGGGGCACCCACGCATCGGCCGGGGACACGACGACAGCGGTGGCGAGTGCGG
CGGCGGCGCAGAGGCCGCGGGCACGGGAACCGAAGGCCATTGTTGATGAGGTTGGAGTGAGGTGAGGTGAGGGGCTGTAAGTACTGAGTCGACCTGTGCA
GGGCTTGTCAGTGGGGAGTCCGGTCGCTTCTCGTCGACGGCGAGCAGCAAAATGGAGAATGAAGAGCGGTCAGATGTCAGCAGGTGGGAGAGCGAGCTCA
GCTCATGCGCTCTTATGAGCTGGTGTCAGGATTTGGGGCTCTACCGGCATTTGGACGACGCAGCTGCAAGTGACGATTTCGTGTGTGGGAGGCTGGATAT
TTCGTTTGCTTGCACTCGTGCATGACCGGGTTGACCACTGCAAACTGTTGCTGTTTTTGCTGTTTGTGAGATTGATTAATCCCAGCTGGAGGTAGTACAG
AAGTTTGTCCTACAATTCATGAAAACTTTATGCATAGATATCTCAGGTAAAAGTTGTGTAAAGAAATACATGGGTACTGTAAGGTAAATAGTTACTATGG
TAGCTAATTACTTTGGTTCTTGGTATACACATGAAAACTAAATTGATTTGGGAAGGTTATTATTTTGCATTGTTCCCTTTGTGCTGTAGCATTGTAACTT
TCGCGTAGAGACGACCTCTGCATGTTGAGACTGCAGAGAGAGTCCCAGGGAGGGAACACGCCAGTTGTGTAGGGATCGGCGCCGCCAGCCGCTGGCAACT
CGTCGTGTTGCTGGCGCAAAACGCTGTCCGAATCTCGTTCTGTGTTGCCCTCTCGTCCTTTTCGCCCACTTCGAATTGACACGACCGCGCTACAGCAGCG
ACACCTTGTCCAGCATGACGCTGCGTGGCGAAATACAAAGCACTGGAGCTGCAGGCTTCGACTTGCAGTAGAGGACTGCCGTGCGGTGCGTGTTGTAACC
AGATCGCTCACCGAGATCGCTACCCTGGCTGCATGGGTTTCATACACGAAATATATGACCACCATCGGCGTCAGGGTTCGGCCAAGCTGGACTAACCGAC
AAGGGGGGGGGGTCCAGTAGCTTATAAACGCGCTTCCCGTGGATACTGCAGCGACGTGCTAAGCTTTTGGCGGTTACCATCCCAAAAGATCTGTGCGTGC
ACTGCAG