Description :
From Genome Similarity Track
Location :
Scaffold_1257:1018- 2777
Sequence
1759 bases(100 bases per row)
ATGGTTTGCCTGACGAGATTGTCTCTGATCGAGACACTCGATTTACCTCCATTGTTTGGCGTACAGTATTCGAGCGCCTAGGGACCAAGTTGTCGATGTC
GACAGCTGCACATTCCGAAACTGATGGGCAAACGGAGCGTGTGAATCGTGTGCTAGAGGACATATTGCGGAGTTACGCAACATCCTTTAAGGAATGGAGT
GATTTTCTCCCTTTGGTTGAGTTTTCAATCAATAACTCAACACACGCTTCTACGGGCTACTCTCCGTTTTACATCAACTGTGGATTTCATCCTCGTGTTC
CAGCAACACTTTCGGGGGTAGGTCCTACTTTTGGTGGGGGAGGAACTCCTGTTGAAACAGAGTTAAATGCAGCGAGTGGGTCAGATATACGCGCTAATTT
CGACGCTCTGGTTCCTAAGACCAGAATGTCAACGCGTGACCAAGTGAAAATCGACGGCTTTGTTGACAAACGACAAGCCATCGTAAGATTTGTGCGCGAT
GCAATCGCTGAAGCACAAGATCGGCAGAAGGAGCAATCAGACAAGCATGGGCGAAAGAATTTATTCAAATTCAAGGTTGGTGATCTTGTATTACTTAATG
CAACTCACCTACCGGAACATGTAGTGTCCAACTTTGGAAGTAGGAAACTACTCCCTAGGTTTATTGGACCATTTAAAGTTCTGAAACGCAATGGAGATGT
CTATACTATAGACATTCCTACTAGTATGAGACTTCACCCANgctgttgcagctcctcgatctGGGCACGATGAGCACTCTTCCACTTCCAGAGTCGCTCG
ATCGTTTTTGCGTTCAGCCCCACCTCCGTTGATTGACTCTCACGGAGATCGTCGGTGGCTGGCGGAGTCAATTGTGGATCATAGGGATGATCCGACTCCG
ACGAAGCACCGTCGAAAGAAGCAAGCGAATCGCTTCTTTCGCGTTCGGTGGCGCGGCTACCCGCCGAGCGAAAATACTTGGGAATGTCGTGAGAGCCTCG
CGGCTGACGTCCCCGATATCGTTCGCGACTATGAGAATCGGATGTAGTATCGGGCACCCCGATACTACTTCGGTCGGTGGTTGGAATTGCTTCCGAACCC
CGACGGTCCTTCAAGTTGGTTTTCTTTAACAAGAAAtccatcttgttctcgtTCTCAAGGCGAATGAAAGTTCGCCAAGAGTTAGTTTTGGCGACAAGCG
ATTGGCCTGGATCATCACGGTGATTGATCCTGCGCCAAGCAAAGAAGCGACTATGATAGAAGTTTTCATCTCCATTGCGATCTCGGATCGAGGAGatgtc
gaagagcttcattGACGTAACCGACTTCTTTGTCCGCTTGGCTGAGCGGGATGTCTCGAGTTGGCTCTTATTCGAGGCCAACGAGTCGTTTTCCGGTTCT
CTTACGCGCTTCATGATGCGACAAGGAACGCGGAACAGAAGCTTGCTGTTTGGAACAGTCAAGACTTTTAGTCACAAATCGGAGGGAAAGTTATCCACTC
CGACCGGATCTGTATCGACAGACCGGCAAGTACGNCGAGTGTCTTGCTTGGAGTGTTCCCCCTTGCGGATTTTCGACGAACACTTGTCAAGCTGGTGGCA
AATTGCCGAATGGGACTAAAGACAGTAGGGTGCCTGTCACCCAGCGCGTATCTATAGCACCGTGTGACACTGTCCACTTGGGACACGTGTCTATGCGACA
GTGAGACTTGTCCCATCTGTCGAATCCCTCTCCCAGGAAAACAGAACAGACATTTTCAG