Description :
From Genome Similarity Track
Location :
Scaffold_952:10178- 14138
Transcript NameFunction/comments
Phypl_g11795hypothetical protein PHYSODRAFT_545408
Phypl_g11796hypothetical protein PHYSODRAFT_301465

Sequence
3960 bases(100 bases per row)
ATGCAGTCCGCCGTGCGCCAGCGCTTGTCCGCCTCCTCCGGCCGCTCGGCCTCgctcctgcgccgcgccgcgtccgccaaggcggcggcgcccgaGCCCG
TgttcgccaagcgcgacggCTCCAAGGGCGAGAtcgacagcgcgcgcgccttcATCGAGTTCAAGCGCGAGGCCGACCCGTAccgcgacgtggtggagcg
cgtgcacgaCTGGAACGAGATCAACTCGGGCCGGCGCGACCCCACGGAGCGCAAGATCCAggcggcgcgctgcatgGACTGCGGCACGCCCTTCTGCCAG
ACCAACACGGGCTGCCCCGTGAACAACCTCATCCCCGAGTGGAACGAGCTCGTGTTCCGCGACGAGTGGAAGGAGGCCATCGACCGCCTGCACAAGACCA
ACAACTTCCCCGAGTTCACCGGCCGCGTGTGCCCCGCGCCCTGCGAGGCCGCGTGCGTCGCAGGCCTCGTGGACGACCCCATCACCATCAAGAACACCGA
GTACGCCATCGTGGACCGCGCCTTCGAGGAGGGCTGGATCGTGCCGCGCATCCCGCGCCGCAACGGCCtgcgcgtggccgtcgtgggcTCCGGCCCCGCC
GGTCTCGCGGCCGCCGACCAGCTCAACCAGAAAGGGTACAACGTGACGGtgtacgagcgcgaggacCACATCGGCGGCTTGCTCATGTACGGCATCCCCA
ACATgaagctggacaagaagacggtgaACCGTCGCGTGGATCTCCTGCGCGAGGAGGGCATCGAGTTCGTCACGAACGCCGAGATCGGCGTCAACACGcc
cgtggagcagctccaggccgagaacgacgccgtcgtgctcgccCTGGGCTCCACCGTCCCGCGTGACGTGGAAATCCCAGGCCGCCACCTCAAGGGCGTC
CACTTCGCCATGGAGTTCCTCACCAAGAACCAGAAGCGGCTAATGCTGACGGTGGacggcaagctgcagagcggATGGGACCGCGACTTCGTCACGGCCG
AGGGCAGGGACGTCGTGGTCATTGGCGGCGGTGACACGGGCACGGACTGCATCGCTACGTCCATGCGGCAGCGCTGTAAGTCGGTGGTGAACCTCGAGCA
CAACCCGGAGCCCCCGGCTCAACGAGCCCCCGAGAACCCGTGGCCCGAGTACCCGCGTATCTACGGCGTTGACTACGGTCACGCTGAGGTGCGCTCCGTG
TTCGGAGAGGACCCGCGCAAGTACGCCCGCGTCACGAAGGCGTTCAAGGGcaacgagaacgacgagatcACGCACGTGGTGACCGTGAAGGGCAACAAGG
ACCCCGATACAAACTTCATCACGGAGATCCCCGGcaccgaggaggagatcccGTGCGACCTGGTGCTGTTCGCCATGGGTTTCCTGCACCCGGAGCAGAA
GATCGCGGAGGCGCTTGGTCTGGAGGTGGACCAGCGGCGCAACATCCGCGCGGCCTACGGCGACTACCAGACGTCCGCGGAGGGCGTGTTCGCCGCTGGC
GATTGCCGCCGCGGCCAGTCTCTGGTTGTGTGGGCCATTAACGAGGGCCGCGGTGTTGCggacgccgtggagaagTACTTCCTGCAGGAGGGATTCCAGC
CGGAGGTGTCCCAGAACCAGCGCTTCGGTTAAATCCGGCCACGCAGCCTCAGATGGCAGTATGTACCGGTCGGTAGACGAACGCATCCACGGCTTATGAA
GGCGCCGCCGAACTACACGACGACAAAACCTGGCTGGAAGGAATCAGCAACGAccgaagcagaagcagagATGTAAAAGAAGAGGGATAATTATTGTAAT
ACACACGGTGAATCCGCTGAATCGACTTGCGTCTGGCGCAGCTTGGTGGCGCGCCGCGTGGCATTCAAGGAGTCGGCatgacggcggcagcggcagcaag
aagcccGTGGCGCCCAATGCGCAAACACAAGGACATCAAAGTGGCGTGGATGCTAATGGATGGTGGTGCATGGTCCGCGTTACTGGATGAGATCTCTACA
TGCGGATGATGGGCACTCGACCGCGCAGTTTCGAGACCCCGGCCTTCAGGGCAGCGCCGTTGCTCTTGTTGTAGCGCAGGTCCAGCACCCGAACGCCCGT
GAGCATGCCCACGTCCGTCACCTTGCAGCAGTCGGACAGGTTGAGCTCGTGCACGTTCTTCAGAGCCGACACGTCCTCAAGCTGCACGCAGCCGGAGAGA
TTGAGCGTGTGCACCCTGGACAATGCAGACACGTCACACACGCTCGGGCAGTGGCGCAGGGAGAGCGTGTGGACCGATTCCAGGGCCGACACGTCTTGGA
TGTTGGGGCAGTAGCTCAGGTCCAGCTCTCGAACGCGTGTGAGAGGCGACACGTCGACCAACTTGGAGCAACCCGAGAGCTTCACGATTCGAGCGCTTTG
AGCTAGTGGACGAACGTCCTCCAGGGCGTCGCAGAAGCGCAGGTCTACATCTCGAGCCCCAGAGAGGAAGCTGACGTCGCTGATGTGAGAGCACCCGGAC
AGGTTCACCTTCTGGAGATATCCGACAGACTCGGTCAGCACTTGAATGTCCTCGAGATTCTCGCAACGGTAAGTTGTGATCGTGTGCACCTCGCGCAGTG
AGGGTCCCAGCGATTTTAGGTTCTTGCAGAAGCTCACGTCGAGTTCACGAACGCGCGTGAGACCATCGAGCGACGTCAGCTGACTGCATCGTGATAGCAC
AAGTCGAccgagcggcggcaggtggcgcagctcggaGCTTTCAAACCCCGTGCAACTCGCCAGATCCAGTTCGCGTAGACTGGAGCTCGCCCCCAACGCT
GAAAGGTCCGCCACCGCATCGCATTGCCGCAACGAAAGCTCTTGAACGCCATTGCCTAGCGCAGAGATATCGCTGATGTATCTGCAgagagcaagctgca
gcttgggaACGCGTCCGAGCGCACTCACATCCGTGACGTTGATGCAACCTGTCAGATCCAAGTCTTGAACACCGCCAAGCGCCGACACATCAACGATTCC
AGCACATTTGCGCAGTTTGAGCGTGTGCACTTCGCCGAGCGCGCTGACGTCGGTCACGTTGATGCAGCCCGAGAGGTTCAACTCGTACACGTTGGTCAGA
GCACTGACATTCGTGACGTTCGCACACCCACCAAGATTCAGCTCGTGGACGTTACCGAGTGCGCTCACATTGCTCACCTCTGGGCAATTACGCAGACTCA
CGCGACGAACGTGACTCAGCGGGCTAACATCACTTACTCCTCGGCAAACGTTGAGCTGTACGGACTCACATTTTGCCAGTGGAGAGAGATCTGTGACAGC
GTGGCAGTACGACAAGTCTACGTGTTGCGAACCGCTCAGGAACGATACGTCCTCGAGGAAGTTGCAGTAGCTCAGGTCCACCTCGCGAATGCCTTTCAAC
CAATGCAGCCCGTCGATCTGGCTGCAACCACTCAGCCCAAGCTCCTGCAAGCGGCTCACACCGTCGAACAAACTTACTCGCACGATTCCCGACAAGTTCA
ACCGCTTCACttgggcgtcgtcgccgccccGGATGCAGTCTTGCAGTACCTTCGGGCACATGTATCGCATCGGAACACTCACTCCATCTTCGTCGATGTA
GCTCTCGTTGGTCGCTTGAGCTGGTTCAGGCTCAGGTGCTGGTTGATTGCGCTCAAGGTCAACGATGagtccgccagcagcgttCACGTTGTAGTGAATA
CTTTCGTGCAGTCTGCCGCCCTCCGGGTCATCGCTGACAGGTTGGAATGCCACGTTTCGGAGGTTGCGCCACTTGCTCAATACTcggagcagctctcgaa
cgGTGCAAACCAGCGATGCCTCGGACCGTAGCTGGACGTGTTCATGCACGACGTCGTAGAAGAATGGGCTCAATTCGGCCaacgccaccgcctcgttCAG
CGTCAAGAACGGAATCACGTGTTCGTCCCAAAGCTCAGTGGGCATcgtgcgctgcaggtg