Description :
From Genome Similarity Track
Location :
Scaffold_983:10177- 11513
Transcript NameFunction/comments
Phyag_g8979hypothetical protein
Phyag_g8980hypothetical protein

Sequence
1336 bases(100 bases per row)
CTATTCTAGACAAATTCTGCACCACCGTCACGAGCCCCATGGTGCAGCGCCAGATCTACCAGACCAGACACCGCGATCTGTCGCCACAATTGGCGTTTGT
CCTcgagaagcgcgtggagaagcagtgTAGGAACGGCTACTACGACTCGTTTGGCGGGGTCAGTTCTTCTTACAAAACTGAAGTTGTACCGACATCTTCT
GGCGAGGATTCGCGGCCACGACAAATGTCCTCTCGGTCAGATACCAAGTCAGGGATGTTGGAGAGGCATGCAACAAGTCCCATTGCGGAATAGGGAGGTA
GATAGCAATGGATGTGACGCAGGCAAGGTGTCCCGTAAGTAAACTGAATGCTTGACCAACGTAGCAACACATAGCTTCAGAATGTCCCCAAGACTGCTTA
TTGTGTGCAATGATGGATACATTTGGCGGACACAGGCACAAAGCACCGGATGCTGGTTGTCTGCAAAATGTGGAGGCAGCATCGAAAATTCTGGACGGTT
CAACGGTAGGCCGGCCACGACCCGGCCGAGATACTGGTCTCCGGCTGATTCATACCGAATGTAGCGGTCTTGGACACCGCCAAGTGACCACCCCACTCTA
AGACACACGCTAGCAATCGATGGACCACCGGTAGATCCGCTGCATGCAAACGTAGCGACACCTTTGCGAATCGAATGTGTGCCGTAATGTGTTTGGTGCT
TGAGGTCACTTATCAATTGTCGAAGAATGCTTCCGAACCGTGATTTCTGCTCAGATCCAGGGAAAATTGGTCCAGGTGGCTGANNNNNNNNNNACACTGA
CAGACTTCcgcttctccagcaaaaaCTCTTCAAAATCGACGGCCGTGAACTTATCCAAGTTAATTTGCCCTTTAGCATCAAAGTactctgcagcatcttc
ctgCGTTTGCACCTCAGTCCATCGTGATATCACTCGCAAGCTACCACGATACGCACGCTGGGTTTTGGGCGATACGCATGCATCCCTAACATCTTGCGCG
GTGACCTCTCGATTACTGTCGGCTTGTGCAGGTTGCGGTGCCTCCACTGGAGCCACGACCGAAATATCAGCCAGCAAGCTGCCTGAAACACGACTGATGG
TGGCCAACGTGGTTAAGCCTTTGTGAGTCATGTCCGGGACCACCgcgtccaagtcgccgaCATCAGTGTCCTGGGCCaccatggccaagctgctgtcgtc
cGCGTTCACGTCCACCGCTTCTGAAGGTTTAAAATTGCGCGTCGTGGTCGAAGTAGAGGACTTGTGTGGCGTGGAGGTCGTGGTCGAATCCGATGGCGGC
AaactgctgcgcttcttgtgggGAGGCGACGTTTTG