Description :
From Genome Similarity Track
Location :
scaffold_330:10175- 11395
Transcript NameFunction/comments
Pl_106016conserved hypothetical protein

Sequence
1220 bases(100 bases per row)
TGAGCGAAATGAACATCACAACTACTGCAAGTTCACTTACAGGATCAAGTCCATGGGCAAGGCAATGAGTCCAATGCCGCAGAAGATTGAGAAACCAAAC
CATCCGACGAAACTCGTGAGACCCGTAACATACACAGGCAGTGACACATCAACTTCCAGTGTGATATGTTGCACGGTGATGTTGCTTGCTGTAGTTACAA
GGGTAGATGATACCGTGGTCCCATCAACGTATGATTGGAATCCCTCAGTGGTCGACATCGAGTTCACTTCCAAGGCACGCATGGGAACGCTACTCTTGGC
ACTCGTAAGGTAGAGCACCGTGATCAGTGCAACCGCGACAACTATTGTGCCTATCTCCATCTTGATTGCCTCTCCCCATTGACTCTTCTTGGGGTTGTCG
TCCCCCTCATCCGCCTCGTAGTAGAAGATCGCAAACGGTAGCAGCACGACAAGGAAGATCACGATGGACAAGAACACCATGAGCCACAGTAGATCCATGT
TGATGTTGCCGCAAGCGGTATTCCATCCTTCCGCACAGCCGACAGCTGTCGAATTGTTTGCCACATCCAGCGGTAGCAGAAGCACCGTCGCCTCTGCAAA
GAATAACCCAAATATCTGTCCATTGTACATTTTAGCATTGAACTTCATCAATTCTACAAGACAAGCCGTACCACGAGCGCTTTAGGGAAATATGCCGTGT
TCTTGTCGTCATCGTGCTGGAAATACACGAGGATGTAGACGTTGCAGATAAGTAGTGCCACCGCAATGATGATCACTACGGCCAGTAGGAACAGATCCAC
TGCCATGTTATGCTGGCGATTCCTTTCTCTACGTGAATGGTTCTACTACTTGTTGCCTTTCTGGCCAACACTTGACCACAATAGCAAACGTAACGGACCT
GACCGTCGAAACGGACGTCCGAGCGTCTCATTATAATGCAACAACTATCACTTGGCAAGCTATCCCAGCTACACTATGAATGTTTGGATTGTGGGCCTCA
GAAGGTTCTTTTGACGCATTGCAGCGCGGTCGTAACCCCGCTACTCATGCAGTAATTGGACATAATGTTGTGATCATCACAGGCTTCCACGATAGTTACA
AACGACACCAACTCTTCTTTACACAGCTAAATACTGAATGGCGTTGGAATTCAAGCGTGGAGATCGCAGAGCTTCTCGTCCAACCATCTGTCATCGTGTG
GTGCACACAAAGTGTCCGGA