Description :
From Genome Similarity Track
Location :
Scaffold_23:101730- 103074
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_06609cell 5A endo-1,4-betaglucanase

Sequence
1344 bases(100 bases per row)
TTTGCGAGCTGCCCAACTTTGTCGGGGATGGCTTTGGCGGTGTCGTCGCCAAGTACTCGAGCGGTCTCGTCAAGCCGATCGTGATCACGGGCATCAACTG
GAGTGGCATGGAGAACGTCGAGGGCGTCCCTCACGGCCTTGCGTTTGGCCAGTCGACGATGGATGCGATCTCGGCCAAGCTCGTCGACCAAGGCGTGACA
GCCGTGCGCCTGCCCCTCAACGTGCAGATGATTCTGAGCAACGCGGCGCCCAACGTCAAGGACTTCGTGGACCCGGTCGTGAACGCCGAGTTCAACGTCA
ACAGCTACATGGACATGATCAAGAAGGTGATTGTCGGTCTCGCGAAGCAGCAAATCGCGGTCCTTCTCGACATCCACAAGCTCGACCCGAAGAACCTCAA
CACGGACGCGTCCGAAGGGCTCTGGTACAGTGCCACGGTCACGGAGGCGCAGACGACGAAAGCCATCACGATGCTGGCGACGACGCTCTGCAACGCCAAC
TACTACAACGTGATTGGCATCGACTTGAAGAACGAGCCGCACAAGGGCTGCTGGCCCGCGTCGGCGACGACGCCGGATGCCTCCTGCCCGGCCAGCAACA
ACTGGCAGCAAGGCGCGACGCGTCTCGGCAATGCAATGCTCAAGGCATGCCCCAAGTGGATGGCGTACGTCGAGGGCACGCTCGAGCAGATTGAGGCTGC
GTATCCCAACACGAACGGCGGCGCGAAGCTGTCGTACGGGGACTGGTGGGGTGCGTCGCTCAACAATGCCTCGACCAACCCGGTCGTCCTCAGCATCAAG
AACAAGGTGGTGTATGCGCCGCACTTTTACTCGCCGAGCGTGTACCCAGCCGCGTACTACTTTGCGGTCCAAGACGGCGACAAGAACATCTTTACCGAGT
TTCCCAACGACGCCGACGGCAACGCCAAGCTCCAAAGCAACGTGTATGCGGCGCTCGACCGGTCGTTTGGCAAGGCGATGGCGGCCGCGAAGGCGCCGGT
CATGTTTGGTGAGTTTGGCGGCATCTACGGCGTCAACGACAAGTGGCCGAGCAAGAGCTCGACCCGCGCGATCGAGGCGTTTATCTCGTACTCGCAGGAC
CGCAACATGTCGGGCGGCTTTGCGTGGAGTCTCAACTCCGAGTCGTTTTACGAGTACAACCCGACGAAAGGCGAGTACATGTACGGGCTCTACACGGACA
ACACATGGACGGCGTACAACGAAGACTACTCGGCGGCCTTGCGCAAGTTCAAGGGCTCGGGCACCATTTTCTGCGTCAAGGTCGATGCGTCGTCGGTCGT
CGACGGCGCCGAGAGTGACACGAGTGGCAGTGCGACGAGTGGCG