Description :
From Genome Similarity Track
Location :
scaffold_137:10171- 11291
Sequence
1120 bases(100 bases per row)
GAACACAAGGATGACGTCCTGAGTACGAAGCCGCCCTCCGGTCTTCCATCCAAACGTGGATTTAGACACGATAATCATCGTGAACCCGGTTCACAGTATG
CAGTGcttcgacagtggccactgtcgcgTGAACAAAGTGAGTATGCAGTGAgttctttgctcaaaaaaAAGCTGCCGGTTTGGTGAGGAAAAGCAAGTCC
CCTCATAGCGCGccgacgttttgtgtgcgCAAGTCAACGGTGAATGGAGTATCGTTCACGTCTATAACAAGTTAAATGCGCAGACGATTTCCGCTCAAAC
GCTGAATTCGCGCAAGGATGTCATCATCCACCGTATGTCTGGCTGTATACCGTTTAGTGTACCTGCTTTGGTTGATTGATCTTGATGAGGAGGAGGGTGT
CTTTTCGACGGCTGTGAGTACACCGTCCGGTATGTCATGGGATCTGCTTGTGCTGCCACAGAGACTATCCAATACTCAGTACCGTTCAATTGATTGGTCT
CCCATCTGTTTCGAACATTACGATGCTTTGCACAAACCTATTTTGCCGATATCTTTGTTCATTCGAAGGACGAAGATGGCAGACCTGCCGAAGAAATGCA
CTTGGAGCACCTCCGTGCAGTGCTGAAATGAGTGCGTGAAAATTCATTGCAAGCGAATCTTGCAAAGTATAACTTGGTGCTAACAAAGTACCAGCCTTGG
TTGTTATGTTTGTGAACACGGTGATTGTGCAAACCCTGGAAAggtcaaagcaatcgtgAAGTGGCCAATAACCTGCATTGGATCTCGGGTAACTACGCGG
AAATGGTGCACCCACTATCAAACTTGTTAAATAAGGACGTATCACGGGAATTTACATCCACTTGTGAACAAGCATCCACTCAGATCAAGCACAGTTTGAT
GGAAGCAGCATTACTTGCTTTACCAGATGACACGAAGCATATAGCGTggtgtgtgacgctttgAATTTGCAATCGGTTGTGCATTTTTGTTAAAGGACTC
AGAAGAACACGGTCGTGTTGTGTCATCCCAATCGCGACAGACTAGCCTAGCAGAAAAGGACTAACCTGTCCACGACGAGGAGACTTTgtcaatgaagtat
gctctgGTGAAGTTTCGTGT