Description :
From Genome Similarity Track
Location :
Scaffold_945:10170- 11171
Transcript NameFunction/comments
g11104.t1hypothetical protein

Sequence
1001 bases(100 bases per row)
TACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATG
GCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTCGAA
TTCATTTGTGTCCTCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGACG
CTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAA
GTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCTATGACTGCGCGCAGTACGTGCGCGAGTCGTTACAGCTGATACATTGCTTGTATCAGCGTGCT
TATCCGGTTGTTTCGATTTAACCGGATACCCTCCCCCACTTAAGGAAGAAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCAC
GTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCTATTGATGGAACGAGTGCGCGTAG
CTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGATGATCCGCAGTCGACATGGACAGCTGTGTCCCAAGAAGTG
TAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGTATACCATGGTGTCTAAACACCATGTCGACAAACAG
ACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACTATACCAGTCCTCCGCTTG
T