Description :
From Genome Similarity Track
Location :
scaffold_158:10168- 11456
Sequence
1288 bases(100 bases per row)
CGAATCTCGTGGTGAGCGTTGTGGTTGGTTGGGATGATTGTTGGTCACGGAGATCATTCATCTTATCATCGTGAAAAGAAGCGTTGAACCAATAGCGCAC
CTATGATGTTTGGTGGTGCGGCTATCTATCGGATTCAGGCACATACGAAACTCGTCAGGCCCTAGGGTCTGATGAATTCGACGTGGTCCACAGCTACGAG
GGTCGCTTGAAGTGCAACACTGCGACGACTAGAGCTGGGTTAGGTCCGGTCGCGATCGGAAATCCTGTCAGCGCCGACTAGATGGAGCAGACGCCCCAAC
TTGTTCTCGTTCTTAAGTAGAACAAGCATTCTACAAGAGCCTGCCTTAGCCGCGATGAATTGGGCCAGTTCATCACAGTTATTGATCCTGCGCCAGCAAA
AAAATGTCCATTATCCAGAAGAGTTTCTAAACCTTTATTTGCCGCTACAGCGATGAATCCTCGTCAATATTGGCGTGATCACTTGATCAAATCATTGCTG
ATTTGGGATATAACTGATCCAAAAGTTCTGAACAAGTATAAAAATACTTCTGGCCTTACGGATGGGATGATGTGACGAAAATCATATCGCCGTTACATGA
AAATGCATAGATGTACCTTCTGAGTGCATTGTGGGGGTTTGTACCAAAGAGATTGCAGAATGGTACCCCACATGCATATGTGACTTCTTCTATGAGGTTA
TAATCATtctgtgatacagaatggtggTTCGTACTTGGGGGTGATGTCTTTATCTTTTGAAGTGAGAGTCGTAGGCTAGTCATTTTTATTAGGAACATTT
TGCGTAAGTTGAAGGTCCAGTTTTTCAAAGTGCAAGCTCCTTACATCCGATATCTTGAATAAGTTcaagctgaggttcaacttcaatttttttattgtaT
TAGATATGTAGGGACCTAAGATTTTATTAGTAAAACTTTCCGGATCTCTTGGTATGTTTTGCTCTTAGCTCTAGGAACCATGACCTCATTTTAATCAGTT
GTGAATTTGCTTTCAAGTCACCATGAAGTCCATCACAGACGGAAATATCGTTCTCTCTTCAAGTCGGAAGTCGCTCTCTCGTCGTACAAGCGTGTATTTC
CTGTTAAGGGGCTGTTCTAAACAGCACTCACTTACGTGCTGGTTGCAGTGCTGAAAGCATCATTTAGACGCGTGGCACAACTTCCAATGTTTATTTTTTC
AGTCATTTCTATGCATTCCATCACAAGGGTGCTTGTAATTGCAGCATTTTgctaatatattcacttttgcCGCGTCCAGAGGCACTGC