Description :
From Genome Similarity Track
Location :
Scaffold_153:101674- 104104
Sequence
2430 bases(100 bases per row)
ACGGCGACTGATGACTCTGAGAAGCTTACCAACTTAGCCAGTGTTCTGCATTTTTCATGGAACGAACTCTTAACGTACTTACTACCCAACTTTCTGATAA
CTTCCCTATCGCGAAACATGACATTATCGAGCCAGAGCTGGTCATAATGTAGTTTCTTGGTATCCTTAACGCTTTATGGCCTCATAAGGCATCCTGCTGC
TATAGAGATAACGCAAACTCTTAACTTTCGGAATACCCATACCGAGGGCGCGTCCCATCCTTTTTGCTTCAGTCTCTTATCTAGAATGGAATCTATATAG
TCTTTGTCGGTTTCTACGACAACGCCACAGAAGCATATCTTCCAGTCTCTCTTGCCACCATAACTTCTCTTAACTACCTTCAGGGAGACGTAGTCTTCGA
TACTAATTCGTCCGTCACTAGCCTGAACCTAACGCCGTGTACGAGAGACATAATATTGATAGCGTTAGTACTGATGGTAGTATACTCAGAAGCTATGAAT
CCCTTCCAGGACTTCCGAACTTTTCCTATCTCGGTATCGTACTTGGCTACTTGATCGAATGGCATGAAAACTCGCATCTCCACTAAAGCGTTATCGCACA
TTAACGCAAATAAAGTAGGTCGGAAAGCGCCGCTCTCTAGTTTAGTGAACTGTTCTTGATGATACACAGAACCGTTATTAACAGCCTCTGTACATGCTTT
GAAAGCAAGGAAGTTGTAGAATTGAAGCGGTTGTACTCTATCTATCTCATTCCTAACGCTAATCCAGATTTCGCATATGGTCTTGTGGATGTTATTATCG
TTTCTTATCCACTGGTCTTTGCGTAACTTCGACATACAACGATCCCACGTCTTGCTGTTTCCGGACTTTCCATTATGTTCCACGAACAAATAGTAGTTCT
TGTTTTTCGAGTCTCTGCAAGCAGTGGTTAATACAGGTGCGTCATAAATGTTGTCGTAGAATCGAGGCACTGCGAATGACTTGTAATTAGAAGCTAGGTT
CCTGTTATCTACATTCAACGTTTCTTCGTACGCGATGTTGTCATCGCTTAAGTCACCTCCCATGAGAAACAATGAAGCTGTCGCCTTCATAAACTGTCTG
TTAGGAAGGTTAGTAGTAACTAACTTAGGAGCCTTTACCTTATCATTCCATCCGGGAAGATGCTTCTCCAGTGTGGCGGAATCTGCGAGGAAGTCTTCCT
CCTCATTAAATCCTAAGAGTTCTTGGAACTCAGCGTCCATCGTCAATGTTGATCGATTATTTGCTCCCCATTTTTTAAAAAGGCATGTTGAATTATTATT
GATGGTTAGACTAGACACGGAATTTAAGTTTCGAATTTGAAACTCATAATACTACGGACAAGATCCTTAGCTTTGCTTACTATATCTAGTAAGAGGAGAG
CTTCTGTGTCTACAACGTACTCGAACACAGAAACCAACAAAATAAGTACTCTTGCTCGTATAACACGGAGGTATTCGCCTTCGTTGACCACGTTAGAGTT
AGCGATACTGAATAAAACTTCTAATTCTGTCTGAGATAAGGTATCGCTTTCCATCTCGTCGACCATGTTCTCGTCATCGACTTCGTCGACGATGTCATAT
TTGTCACTTTCGTAAGCTTCATATGCCTTGTCGATGACTTCGTCGATTGACACTTTACTCCCCACGCACTTCCTGTACTGAGAGTTTCTGTCTATTGTCA
AACTATCGGAATACGGATTCTCTGCGTCGTTAGCGCTGATATAAGATGCTATTTTCATACACTCCGAGAATTCACTGTAATACGCAGCGATGTCGTCTAA
CATACGTTTTCTTACGATCAGATTGTCTTCAGTTTTTGATTTGTACTGGTTCCAGAAATGACGCATTTTCTTGTAGGTTTCGATGAAATCCAGCGAATGA
CGAAAGAAAGATTTGTTTATGATAGCTATTTTATGAACACTTGGTGTACTACTGGTGTTGTTGATACATGCACCCTCGCCGTTTATATCTAGGCACCAAA
ATACACTCAGTATGAACGAAAATACGTTAATGTACCGTACGGTCATTACTTCGGCCCTAACATCGAGTTCGGTATGCGCTCTTATCATGTTGGTTATGGA
CTATCACGCGGAGTTTTTTTTTGCTCCTGCTTCTTCGTATTTACAATGCGCTTACTAACGTTATATACTCCCCGTACCTCTGCTCTTAGAACACTGGATA
TTATGAGTACAGGATCGTACTATGATATATAAACTCTCTAAAATTAGGGGGCTTGCCGACGAAGCCTTATGAAATTAACTTTTCAATAAGGTCCTTTACT
TGTTATGGTTTGCTCCTGCCACTGCCTCTTCGTAATGACTATGATTTGCGCGAGCGCGAAATCGGCTCAACTATTTTATCAGGTTCAGTGGCGGCTTTTC
TGTTTCTGAACTCAGTAGAGTATTTATATT