Description :
From Genome Similarity Track
Location :
Scaffold_6:1016698- 1020296
Sequence
3598 bases(100 bases per row)
ATGATGCCACTTTTAGCATGGTAGCTCACAAATTTATTGCGCACATCCACATGCTTCAATTTAGCAGACGCTCCATCTCCTTTAAGCTGTTGAAGCGCCT
CCTGATTATTACGTAAATGACCATGGGATGTCTACACTTCACCCCAATTTCTCCTAGTAGCTCTCGTAATCCAAGCATCTGTGTTACCACCACTGATGCT
GCAGTAAATTCAGCCTCCATTGTTAACAACGACACGTCACCTTGTTTTTTCGCCAACCAGCTCACCGGAATTCCATCAACAGTGATCCATCCACCAGTAA
TTAAGTTTCTGTCTATTTTGTTAGCTACAAAATCAGCGTCACTATAGCCAGTAATGGTTACCAATTGATGACTAATATTACTTGCCTCATTTGTGAACGC
AGCGAATTGCTCTCTTGCAAATATCGCACAATACGTTTTGACAGGTTCTAGTCTCCTATAGTCGGACAGTGTATTCTTGAAGAAGCTCGGTGAACCGCGT
AGGATATATCTGGTCTGATACAGCACGGCAACCACAGCATACTTCCCACTAAAGATTGAAAACGCTTAACCGCTATCTTTCAATCTCGATTATTAATCGA
CAGCTTTTCAACCATCAAGTTGATCTTGTTCACTTCTTCGTCGATAGGCATACGAACACCACGTGCTTATTCCAATCCATTATCCTTTATCATTTCCCGG
GTTGTCACTTCTCGATATATAATCATACCCATTTTCAGGCGCATAAGAAATGCGCATCCCCAAGAATTTTGTCACCTCTTCATAGTCCTTTACCGAGAGG
TCCTGTAAATCAACGAAAAAACTGTCCACGAGAGTTGAATTCGTTGCAGTCACCTGTAGATTGTCTGCATAAACACCAACCACAACAGTTTCTTCTTCCA
AACGTTACTAATACATACCCATGTCGGTCAGGCACTGCATTGAACCCAAATTGGCTAGCTTTTTGTGAAGTAACTCGCTCCACAAACGCCCCGCTTGATT
AAGTACGTATAGAGCCTTGTTCAGCTCCAAAACGAGTTCATCCACACGTCTTGCGTCCAGTCTGTCCAACATCGCTTGCTTGATGTCCATCCCCTTTGGT
ATACGCAAATAAGTGCTAAAATCCGATTCTTATTTGGAATACCTCCATGCTTGGCTGGCACACAGCCTGGCATTGAAATGCTCAAAATTACCATTAATAT
CCTTTTGGTTTTGTAAACCCATTTTGTATGCAGGCTATTCACGTGATTGGGCAGACGCAGTAAGTTCTAGACTCCGTTTTCTTCGAGCGCACGCAACTCT
TCGCACATCTCCGCTTTCCACTGTTCCTCTAGAGGGCTTAGCACTGCCTGACCAAATTTCTTTGGATTCCCATCCCGCGTGGAATTCACTATTATCTGCA
TCAACTTCGGCGCTTTGTTCTTGTTCATTCTATTAAGTGATTTCTTTCTGTTGAGAACGAGTAAATGGTCTTTCTTTCGTCCAGATCGACTTCTTTTTCT
TTAATTCGCGGTCCCATGCTCCGCAAATGTACCTCCACTCATGATGGTACCTTTTGCAACGGCGTTCGTCTCTTGCAATACATATTTCTGGACTTGCTTG
TTCTGCCCGTCGTTTGGGTCTCTATATTCTTTATATGCTGCGTAGTAATAACGACTTGGTATTTTGGACAGTAAACGTGGTATACTTTAATAGTACTTCC
AATTCCAACAATGAAACCGCGCTGACTTCGCTGAGAAAATTTTTGCTTGCTTGAAAACACCTGCACTTGGTGATACTTTAGCAGGGTTCGCGTTTGTAGG
CGATGATGACATATGCCACATACTGTACTGCGTTCCCCCGAAATTGTAGCGTCAGCCTGCACGTGAAAATAATGCACCTGGACATGTTCATAATATTACG
GTGCATTCTTTCGGCCTTACCGTTTCTTGTCTGATTCCTTGTTTCACTCCTTTGCCTGGCCACACCGGTTTTCTTGCAAGTCAAATCGATATTTTCGTTC
TCCCCACCCGAATCAGTCCGTAGAACATGGATTCTAAATTCGAATAGCTTCTCAAAATACACCAAAAAATGCTTGAATTGTTTTGCAGCGACATCTTTAG
TCTTGGCCAGAAAACCCTTCACGTAGTTACTTTGTGATCCACAAAACTCACCATGTACCTATTTCCAAGCCAATCTCTTGGCTTCATTGGACCCTTCAAA
TCAGATCAAACCACCCCACAGACTCGATCAATCGGCGAGTGCTCACAGGAGTCAGTATTGGCTTGGCGGTTTCTGCTTGTTTTTTTCTTGTACACTGGTC
ATGCATTTTACACGCCTGTTATTTGTGATCTTAATCCCAGAAGCAGCTTCCTTCGCCAACCGCTCAACTGAATCGTAATTTGAGTGCCCAAATCGGCAGT
GAATTTATACGAGGGATCCGTTTTGAGCTGCTCACAAAATGTCGTCGGATTCTGCGCAATATCCACCAACTGCAGCCATAATCATTTCGTGAATTTGTGT
CACATTTCGTCGCACATTTGCTTTTACAACAAGAACATTTTTCATTAAGTAGACATCAAAATCTACTTCCTTTCTATCATTGCTGGTCAGAACTTGCTGT
CTTCCACGCCTGGTGAAGTAGTACCTTTTTTGTCCAGTATTCCATACGATATTAAATTGTGAGTCAATCCTTTGGCGTAGTACACGTTCGTTAGTTTCAC
AATCTTCTATACTCCTAAAGCCGTGACAGTCGGTGTCACATTTCCTTTCTTGCTAATCCTTATCGGATTTCCATCTGGTTTCATGCGTATGCCATCGGTA
TCTTCCGAGTCGTCAAGCCAAATTTCATCGCAAACCAAGTGACGACCGCTATCCAGAATCCATAGTACATCGTCACATTTTAAACCATCCGATATCGTCG
ATGTGAGATCGGCATCATCACTTTCTCGCCAACTCGCTTTAGGACATGTTGCCTTAAGATGTCCTACTTCTCCACAGATATAATATCGCCTTGTATCTGT
AAACAGACGGTCTTGAATAGCACTGACAACTTCTTTTCATATGCGTTTACCACACCTGACTCCCACGCTTGAGCAAAGTGTGCTAACTCTTTCGCTTGTT
GAAGATATTCGGTTCTTCAATCATCGACCTTGCCATCAACAAAATGCGCATACCATGGGAGGCATATTGAACAATATTGTTCCGAACTAGGTAGTTCGAT
GCACCACCCGATGCTTCAGCCACTGCGTTCAAAAAAAGTAGGTGGTATATCCACGACTTTCTTAAGTCTTTAGGGTGCGTTAACGGATCTATCGCTTGGG
ATGGAGTAATGTGAGTTTTAAACGCCTGCAGCATCTGATATATAGCTACTGGATAGTAGGTGTTATATTTCATTAGGCGTCGATCTGCTTGTTGAAGTCA
CGCTCGGCCATTCCTTCCAGATAATGTCATAATATATTTATTTTTACATCTTCGGGACAAGAAAAACCACACGCCGATTGAGAAGAACAATCTGTCTCTT
AAATCATCTTCCCCATTCCGAGAAACCAGATCCTAGGCCTTAATACAATTCCTTCCCGTCCTATGGTTTCATCTTGAGTTTTTTTGTCGCGCATCGGG