Description :
From Genome Similarity Track
Location :
Scaffold_60:101667- 108044
Transcript NameFunction/comments
Phyin_T30-4PITG_17549Myosin-like protein

Sequence
6377 bases(100 bases per row)
CAATAATATCGCTGCTATTCGGAAGACAACGGTTTGCTGTAGTACCAGACTCCATCCGACGATGGTCCACGTATCGTAGTGCCTAACGATGTGAAGTTGA
GGCAGGTGGTCATCAGTGAGTGTCACGACTCCAACTACGGGGGGTATCCGGGATCGGAGCGGACGTACCTGACACTGGCTGGGAGGTGGTACAAAACCAA
GATGTTGAAGTCAATCCAATCGTACATTGCCGCCTGTGAGCCTTGTCGACGGAACAAACCGAGGCTAACGAGGCCACCAGGACTGCTGGAACCATTACGT
GCTCCCGACGAAAGGTGGAGATCGATTTCGATGGACTTCATCACCGACTTGCCACGAACAAAGCGAGGAGTAGATTCCATCTGGGTCGTTGTCGACCGAC
TGACAAAGCGATGTCACTTTGTACCGACTACGAAGAAGGTAGACGCCGAAGGCGTTGCCCGCCTCTTCATCGACCATATCTGGAAACTTCATGGAATGCC
AACAAGCATCGTGTCCGACAGAGACAGGAAGTTCGTTTCGACGTTCTGGCAGCACGTCTTCAAATCAATCGGAGCAACGCTCAAGAAGACAGTAGCAGAT
CGAGCTCAAGGAGACGGCCAGACGGAGCGGATGAACAGGACACTTGAGGAATATTTGCGGTGCTTCGTGGGCCCTGTTCAAGACGACTGGGATATCCATC
TTGCCAATGCTGAGTTCGCAGTGAATTCAACCGGTAACAGTAGTATCAAGATGGCGCCTTTCAAAGCTAATCTCGGATACGCCCCACTAAACCCGCTTCA
ACTTGCGGCGGAGAATCGTGGCAAGGTCCCCACAAGTCGACGTGGAGCTGAGTTCAACGAGCGACAAGCAGCTCTTCTTCGGCGGTGTCAGAAAGCACTG
GTGGAAGCGCAAGAGCGAATGCGCGATGTGTACGTCCGAAACCGGGTGGAGCAAGTCTTCGAAGCTGGCGACCGAGTGTACTTGAGTACGAAACACTTAG
ATCGGAGACATACAGGGTTACCCAACTCAAGCAAGCTTGGTCCGAAGTGGATAGGTCCCTATACGGTGGTAAGGAGGATCCATAATCACGCGTACGAGCT
CAGTATCCAAGCCGGAAACAAACTTAATCCAGTCTTCAACACCGGATCTTTGAAGCCTTACAAGAACGCCACTCGGATGTCAAGGCCCCATGATGTCGTT
CTAGCCGATGGTACAGTTGGACAACTCATCCAAAGGCTTCTCGGTAAACGAACTCACAAGCAACGAGCCCAATTTCTTGTGGAGTGGGTGGGTGAGGAGA
AACCCACTTGAGAGCCGGTCGAGAATCTCTCACAGGCTCCGGATCTCATTCGAGACTTCGAATCATCTAGGAGAAGGAAACGGCGAAGAAGATGAACGAC
AAAGACAGGAGTAAAGGGGGCTCGAGAGCCTACATGTATTCCCACATTACATTCCCTACAACTTCTGCTGCTTCTTCTCGCGGCGAGCTTTCTTTCGATT
TGGCCTGGACTTTCGTTTCCCGCGGCGGCAACGATACCCTGGATTCAGTTCCATCAATCCCATCCATTTGACCTTGCCGAGATACGCCAAGTTGGTCAAA
GGTTCCGGGGTCACCGGCAGTTCAACGCCATCCAGTACGGAAACAGCAGTGTCTGGACCCTTCGCGAGAACAACAACGCTGTGTCCGACGAGACCATCAC
CAATACTCGTGAGGTACACTCCTTCACGCAGTGTTTGGACAAACGTCTGGAACCGTTCCACATTCGTGTACGAAGCATCAAGTGGACTCTGGAAGAGAAT
ATCGTAATCCAACGGAAAATCGTTGCGCTGAAGAACGTGAAAGAATTCCGTAGCTTCCGCACGAGAAACTTCTTCGACAGTGCTTGGGTGATCACGCACT
AAGTCCACCCATAGCTCAGTGGCCGTGGATGCAAGGCCAGTATCACCAAGGTGATAAAGCGCCGCGCGGAACACGTCGATGAAGCATCCTCCAGCAGGAG
AAGCCTGGTCACGGCGCGCAAAATGCTTCTTGTAATAATAGGCGAAAGCACCTGGACTCAGGTCGTCACGCCATTGCATCACTTGATCCATGCGCCGAGC
GAAGCGTTGGTCGAGTTGCTCTTCCCATACCCAGCTCAACTGAAGCGGGGTAATCTGCCATTCCACCAGGAAGCAGCGATGCGGAGATTCACCGCGAACG
TCGTGCAGCTGCTCAATATTGACTGGAACCGAGTAATCCCATGGCGCCGGGTCGTAGGGATTCGCCGTCCGCTGTGCTCGAGAATGAAGGCGGTGAAGAG
GCGGCGGTTGCCAGAGGGAGTATGAGTGTACCCGATTAGGTGATATTATTATCTTATTGCAATGGGTTGTTAGTAGTACTATGGAATGTATAGTATTGTA
ATTAATAAACAGGCAGATGTAGGACGGCTGTGGAAGCTTCTAGAAGCTTCCATCCGTCTGAACTGCGGGGGCGGCACTTTTGGGCGGTTTTCCCCCCAGA
TTGCCCCCGGATTGGTTAAAAATAAATTTTGCTTTGGGTGGGGAGTTACCCAGTGGAAGAAACAGCGTATATTTGGGCAAAAAAAAATTGAAAAAAAGAG
CGGGCATTTCTTCTTTGCGACAGAAGTAAAGCAATGCTATCCGTCTCGGTTTTACGCTGATTTAACGTCAAATACTGCACGGCCCATATCGCACGCAACT
TTGTGCACAAGAATTCCAACGTAAAGCAACAGATAGTTTGGCAGCTGCAAGCGAATACCGGGCGACCGCACACGATTAGCGCTGACCCAATTTAGAGGAT
CGTAAGTTTACATTCGAGATGCAAGAACGACCAATGTTTCATGAATGGTTTAGCGTGTATTATAACATTTGCTCGCCATCACGATAAGCGAGTACCGGTA
AAGCTTCGGAATTAAGAGGTCGATTAAGCTTTTGAGTCACTACATGTACCATAGACCCACGCCAAAAAAGAACCGAACCAAAACCACGGTCTGATAATTA
CTCAGAGCCCTAGCTAAGTAATTTAAGAAAAAAATAGAAAAGAGCCACACTGATTGCAGGCCGACAGTCAAACTTTATTGGACATGCAACAACAAGCTCT
AAATTTCAATCGCAGTTGACACGGAGCTACAGACCTAAACAGGTACACTTTTAAGCTTAAGATTACATGTAGGAAGGCAGACACACGCAAGAGTATTAAG
TAAAAAATAGTAGACCAATCAGATTGCGAAAGTCTCGTAATCGCATCTGTTTAAAAAGGGCATGCACATCTTTTTAACACACACGCCAGCAGTAAGCGTT
CGTGAAGAAGTTTTTATACATTAAGCGTGTGCAAATTGTGCATCTTACCCCCCTAGTGGAGTCTGGTGTCTGTCCGTCCGTCAGTCCGTCCGTAACGGGC
TAGGGTTAATAATCCTCACGCTAATACGCGCGTTCTACTGGCTGCCGAGCGCAGCGAAGGCGGCGTCGATTCGCTAAAATTGCAATATGTGGTGTACACA
CTGTATGTGGTCAACACATCGTACTTAAAATGTACCGCTCAAATTTTGCTTTCATTTTCAGCTGCGGTATGCAAGGCCACGCGAAGGGCGCTGCCTGTGT
ACGCGTTAGTTAGCTGAATTAAAAGGCGCCGATGAGCACACACGTTCTCTATCGTTGTAGGTGCTGTTGATAAAATTTGTAGGCTTCGGTGACTCATACT
TCGGCCTCAATCAAAACATTAGTACTTATTGGTTTAAATATGATTTGATTTGCTTCGTAGTAGGTTTGTAATAATTTAACTTACAGTACTGTTTTGCGTA
GTACTATTCTTAAGACATTTCATATTTTTGCTTGCAGTTATTTGTAGTAGTAGTCCACATAATTATTATGTTAACGTTTATAATAAATCACACCTCTACT
ACTACTATTAATAATTGATACTTTAGGATGTGAAAATTTTAACATATGACTATTATGACTTCCCACCCGACACCCCCCTGCACCCCACACTGCCCTCGGG
AAAAGTATCATCTTCCTCTGTATTTGCACACGACCTTAAGATATTGTGTGATCTTTCCAACAATATATGTTGTGTACATCAAACAAAATCGGAACAGCGT
TTGTGATCAAGTTTGCGCGGAGGCACGCGACTCAGCAAGAACACGAAAAACGATGGGATAGAAGAGCAACACGAAGCACGGAACGTCATGGACGATGATA
GAAGATTTAGCCGATGCAAACCACGAAGTGTTTTACGTAGCGTGAAAGATGGAAGTGCACGCAGCCATGGAAAGAACAGAAGAACGAGAATATGACGGGA
GCGTACGGGCCACGGAAGGGAACTAAATACATAGACACCCCAGCATGCTGAAATGCACGGCTACGGAAGAGCACGCAACTTCGAAGCCACTGTAGAGCAC
GTAGCGGTAAGAGTGCACGGACAGTAATTCTCCCATAGCACCACGGTACAACACGGAGCACAGTCGACCGACCAAACGTGAAAACGCGATGTACCATAAA
CGGAAGATCATCCGAGCATTGGAGCCCGATATTAGGGTAGAATCGGAGCTCACCGAGTCCGACAGCACGACACTACGGTAGCTAACGATCTCACGGACGA
CAGACCAACCGCAACATCGCAAGCTAGCACGATAGCATGGACTGTGCCACTAAGCCATAGGGGAGCACAGCCACAGGAGCTATAGACGGGAGATCTTTGA
GCCACGGAGCACGATACCAGCGTAGAAGCTCAGCTCCCCGAGCCACGGAGGACAGTAGCACATTAAAACTCGATTGCACGGACGGCAGACCAGCCACGAA
AATCACGGGGGTGCTTGGGGTGACCACGATTGCACACCGTGGAGCACGAAGCCCATGTAGAGCACGATAACACGGGCAACGCAGATGCACTACGCGAGCA
CAATACCATAAATACCATTACCACACCGCGATTGCTCCATAGCGTCGTAACGCGGTCGATTAAATCTTACCAGGAGAGCGCGATACACGGGCGACGGAAC
AACACGACTGCGTGGAGGCACCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTGTAGCCGAGACTCTGAGAGGTTGGCCCACTTTCATCATTTCGTCATATCACCAAGTCGGATGTCAATACCACGA
AATTAATTTTCCTGTCCAGTGGACAGTGTCCACTCCGAACTTGTGGACGCGCACGCAAGCGTGTGTGTTAGATCAGTCATGCAACATATCAAGTGGTGAG
AGTCAGGGGCAACTCGCACAGCCGCCAAAGATTCAATGATCGAAAATATACATGTAGATATAATATGAGACAATGATATTTTCTTTCAAATTTATTATTA
TTGCTCGTTATATGTACCGATGCCTCTTCTGTACTACATGTAATTATATGTAGTACTTAAGTACTGTAGTACTCCGATCTTGCATATTATTGCTTCTACT
GTACTTGTATTATTTAAATGCATTTTAATGCCCCCGATTGCTTTTTTTGCTACAGCACGTTGTACATGGTGGGCCAATCCATCTTGCAACCCTGGAATGT
ACAAGCAATTTTCGCTCTAAAGCTTAAGTATTTAGACGCTGATATTATAGTACTGATGACACCTAGAATTTTTACTTACCGTACTACTGATTTCTCTATT
AGTGTTTTTCTCGTCTCTCATTTACTGTATTTACTACATGCAAAATGCTGTGCAACCATTAATACTTTTCTTCAGTTGCAGTCTGCTAGTTGCAAGCATG
AACCCGACCGGCGATCGTCCAACCCTTTCGGTGTCCAGAAGCTGTCGCGAGTCAAGAACTTCTAGTAGTTCGCCTTTCGCCGAGAGAAATTCTGCGTCAA
GTCATGCCGGACGCGCACCCAACACTCCGTCAAGCATGATTAAATCCTGTTTTCCCTCCTGTCTAAAGTCTCGTGGACAAGCGAAAGAGAGTTTGAAGCC
TCTCGTCTCCACCACAAGCTGACCCAGACGTCACCGATGGCTACCCAATCTACCACTAAAACACATAAGTACCTCCCTCCTATCCATAAGCCGCCGCCAC
TCCATCCAAGTCTCGGCGTCTTTTAACCATCTTCCGTCTTCCTCTGCCGCTTTCTACTTGTTCCGATGGAAGAACGAGTTGCGGGCGCTATGGTCGCCGT
TGTGATTGCTGCGTCCAGAGCGGAAGATGCTGGAGCGATAGCTGCTCGGACTACCCGACGAAATTGCCGAACTCGACTCCATGGGCGACAGACTCAACGT
TGACGTAGACATTCGACTGCTCGAGTTGCGGCTATTGGAGTTGGCGAGGATCGAAATCCGCTGGAAATCTTCCACTT