Description :
From Genome Similarity Track
Location :
Scaffold_25:101665- 105352
Transcript NameFunction/comments
Phypl_g1068eukaryotic translation initiation factor 3 subunit, putative
Phypl_g1069hypothetical protein PHYSODRAFT_496419

Sequence
3687 bases(100 bases per row)
GAAGGATGCCGCGGAGTATCTGCAGCGGATTGTCGTGCCGGCATTTGTGGCCGACGTGCGTCGTGGTGCTATCGCTCCCGCTGATGGCTACGCTCTCACG
CAGCTGATGCACTCTTGCGGTATCAACATGCGCTACCTGGGTCGTATGGCCTCGCttgccaagaagctggaggccatTGGCGGTATCTCGAAGTATTTGC
TGGAGATGCTTGAGGTGGAGATGATCTCGCGCGTTGCGAAGCACATCCTGGCTGATGTCCTGAACTCCAACGACTCCATCCGCGCTGCCCCCGGATCGGC
AATTGTAAAGCTCTTGAACGGCATTCTTCGATCCAGCTCGTCTGCTGTGGACACGACGGATGCCTCGGAGGCCAACGGTAGCGATACTACGATGACAACG
GCCTCACTGGATGTCAAGACGCTATGGACGCGCATTGACACGGAGATTAAGGCCCGCTTTGACTACAAGTTGACTCTTTGGGGTCCTGACCGCGACGAGT
CTCGCGGAGAGGGTGTTGCCTTCCCTGTTGGCCGTGTGAACAAGTCGGTCATGCTGCGGCGTTTGTGTCAGCGTCTGGGTCTGCGCGTGGTCAGCCGCAA
CTACGAattctcgtcgtcgtcgcctaTTAGTCTCGATGACATTACTGGTGTCGTACCTGTCGTGAAGACCTCCTTGCCCGCGCATCCGTTGACccaggcc
aagcagcttcttgaacgtGGTCGCCTGCACTTGAGCCAGGGTGCCCTGTCGAGTGCCTACGAGTTCCTTCAGGAGGCGTCGTCTTTGCTTTTCCAGGTGT
GTGGCGCAGCCCACGAGGACGCAGCtctctgcagctcgtcgctcgcTACCGTGCTTTACCACGCTGGCGACGTTGCTGGTGCTatcgcgcagcagcagcg
agcgctggcgctgtacaCGCAGCTCCAGGGTATCGACTACCACGACACGGCCTACGCGCACGCGAACTTGGCGTTGTTCCTGCACGCGAACGCCCAGACG
GACCTGGCAGTGCCGCACATCCGCCGCGCCATTTATCTGCTGGAATTCTGCTGCGGCCCCCACTTCCCCGAGATCAGCTCGCTCTACTTCAAGATGGGCA
TGATGTGCCAGGACGTGGGGCAGATTTCGCTGGCATTGATGTGTCACCGCGAGTCTCTCCGCCGCGGCGAGTTTGACCGCAACCAGGCGGCCAACACACT
GCACCAAATGGCTCTGGCATGCAGTCTGGCTGGCGGCTACCGAGAGGCTCTTGCAtacgagaagaaggtgtACTCGCTCTTCCAGGAGGCATTCGGTGAT
GACGACCCGCGTGTGGTTGAGTCGGCAAAGTATATGGCCAAGTTCACGGAGAAGGCCGTGGAGGGGGCTAAGGGCCGTCGGGAAGTGGATGCCGCTGAAG
CGGCTGATGCGATTGccaacgagctgcttggggaCCTTGAATTCAAGGCCAAGCCTGACCAAGATGCTGGGTCGCCGCctgcggccaagaagaaaaaccg
caaggccaagagcgGTGGGAAGAAGCACTAAGCATGCTCAGCGAGGCTACTGTGTCTCTAGGAAGAGCAAGAGGAAAGGGATAGCACGTCAGGAAACAGA
TTAATAGACAGACTACTTGTTGTTCTCGTGTAACGAGCTCTTCTGTTCAAGCTGAGAGTCACCTTGGAGGTGTTGATGCAATGGACACTGTCTTGCTCTG
CTTTGCTCGCCACTCATGCATTGTCTTCCGCAGTTTCGTGACGAGTAGGTCAACCTCGCCACGGTGCATGCCCAACGCACAGGCAAAGGTGACGTACGCC
ATAGGGAACCCGTCGTGATGCGCCCCAAAGGAGTTAAATTCATGACCAGCAATGGTCTTGCGATCGAGACACGACACCACCCTGGAACAGCATTCACTCC
AAAGTCAGACAGCGCCTCTTCCGTTGCAAATTCCTGTCAACTTACCGTGCACCAGATACCCCGCGCGAAAAGAGCATAGCGCCAAGTAACGTAAGCTGCC
GAGATTTTTCTTGCTTATCCGTCATTCTCGAGCAGAACGTCCCCAGTGTCATCGCAAAGGATATCTGTGCATACGacgtggggggggggggggggggggg
aggtACGATGAGAAAGAGCCGCAGGGCAAACCTGCGTGGACATCTCCAGTTTTGTTCACGCTTACCTCGTTGCTGGAGACATGCAGCACACGCTCCCCCT
CCTCGGTTGCTAATGTTTCGAGTTTCTCGCGCATGTAAGCTGCGAGATGCTTGCGTTCTTCAAGTAGTCGTTGATATCCATTCTTTCCCTGGTGACACGA
GTTCGAGCACAGTTACAGGTTACACCTACATGTCCAGATTCATGAATTTGCCGACTTGTAACACACCATTTGGAGCatcgtgatgaagaagtcgagAGTG
GGGGTGGAGCTGGCACGGCCAGGGTAAAACTTTGCCACGCGGTCAACAACATCACGATACGCCGAGCAGACAATTGCTCCACCTACGGGCACCATGAAAT
TCTTGTCGAGACTCTGCACCACGGCGTCCACACGCCCAGTTCTCATAGCCAATTCTACTTCGTGAACGCACTTGGATGCCTGGACGCCGTACGCGTTGTT
GATCACATGTGCTTCACCACCAACGCCAACAACAGTCGCAGCACTTCGTCAGTCACCACCCTGCAAAGCAACGCATTCAAGACAACGCTTGCTACCTTAC
CAATGTTCCGCTCCTGGCAAAGCTTGGCGATCATCTTCACGCTGTCATACGCTCGTGgcgcgaagcagctcgtggtgctcagCACAGCCAGAATGCTGTC
ACTTCCGTACTGGTCCATCAGTGCCGCCATCCCTGGCAAGTCTGTCCTTAAATATCCGCCAGGGctgccgtcctcctccttcaccaggACATTCGCCAGC
ACCAGTGGCGTCAGCCCAGCCGCCAAGATGGACTTGAAGCAGGACTTCTGGTCGATCCGAGGCCAAATGACGTAGCGCGCAGTGGGCTTCgactccttca
gctgcagcagcaccagcgtgagCGACATGCCCGTGGCCACAGGCAgaaccagcgccgcctgcaccGCCCGCATACCCGCGAGACGCAGCACATCCTTGGC
CAGAGCGTTGGCCACCTGCACCATGAGCGAGGACCCGGCGGCTTTGGgctgcaccgccgccacgtcgCCTGATCGGCCCACGCCGTGCGCCAAGTGGAAG
TGGCGACGCGCCACCAGCGGGGAGAAGACACGCGCCTCACGCTCGCCGGCGCCCGCGCAGCCCCGgaagttgttgctgtccATGGCCGAGAGCGTCTGCA
GTAGCAGCTccacgctggcgtcgtcccAGCCTTCGTCCGGGAGGCGACGCTGGGCCAGCAGAGTCGTCACCAGCTTCTCACGCGAGTGAAGCGCATCCAA
ACCCtgctgcacgtacgtggccgGCACcagctgctcggccagcgctgcagtccGCGAGTTCATTTGAGACGGTTCTGTTCACTATTGTCGCACCGGTACA
CCATTTTTTACTGAGATAGCAAATACCCAATTAACTAGGGTTAAATAGACTACATGTAATATTGTACCTTTCGCCTATTTTAGCGGACAGGCAATTAGtt
atggcgtaattagatccataaataGGTGGtctaccctgatttagcgctaTTTTAGCCTAATATTGTGAGTGCACCctcgaccagcat