Description :
From Genome Similarity Track
Location :
Scaffold_97:101628- 103275
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18948ATP-binding Cassette (ABC) superfamily

Sequence
1647 bases(100 bases per row)
GATGCCTGCGAGTTGAAGACCTGCGGCGTATCCGACGAGGATAAGCATATTTCGAGATACGTTGACGTTTTCCATGCCGTAACTTTTGAGTAAATCCCAG
GCTTCCTGGGTGTCAACCTGCGAGAAATGCTCGAACATGAAGGACTCGAACGAGTATGTGTGGAAGGCCAAATAGTAACCCCATTTCCAGTACGTTGGGA
TAGCAGCGAACGGAACCATGAAACCTTCACACAGCATAAACATACCAAAGAGTCCAGCTCCTAGAGCGATGCCCATGATGTAGTGTGGCACTGCAGCGCC
CAGTAGATGCATCATCGACTCCGAGGTGACGAGCGACAGTGTTAAGTTGAGAAGAAATGACCAAAAAGAGTGGACGCGAGCGAAATATACGACGATAATT
GACGCCAGTAACGAGATAAAGGCGATGCCAGGTAGTGCACCAAGCAGGTTAGCGGTCGTATAGCTGGCCAGATGCAGCGAATGAGAGCGTATCTCGCGTT
CCAGTACGGCTCGTTGCTCCAATAGAGCGGGTAGAGCAGCAACCGACATGAAAACCAGGAAAGCTTGCACGTAGAAGAGTAGTGGCACCATCGCAGAACT
CGTGATCTCACTGTTCGAGCTCAAGTACATTGTACCGACCATGAATGACAGCAACATGTACATGAGTACTCGAAGCCAGAAAACTCCCGGGTGACGCCAA
TTATTGGTCAAGTTTCGATGTAAGAGAACAGAGAACTGATCAAGTCTCGAAGGGCGCATCGCTCGTAGTAGTTCATAGTTGATGAGGTTCATATCCCCCA
GACAGCGGTCACGTGCTATCTCCCCACGTAGACGCTGTGGTTCCGGGCCATCTTCCAGTGCGTGCACGAAAGGGTCGAGACTTAAACTTGTGTGGAAATC
TTTGTTCACCAAATGAACAAAATACTCTGCAGGATTAGAGTAAGTTGGGCACACATAACCCAACGAAAAGAAGTGGTTAAGTGCTGCTGATGCCGCTCCA
AAGTACACGAGTTGGCCATCGCTTAGAATGATTAGATTCGTCAGCATTTCGAACACCGAAGACGATGGCTGGTGGATCGTACAGATGACGTTCTTGCCGC
TCTCTTGGCAGAGTCGTTCAATGTGTTGCATCACACTTCGAGCCGAGGAAGCGTCGAGTCCTGACGTTGGCTCATCGAGCAGTAGTAAAGCTGGATTAGA
TAGTAACTCAACGGCGATACCGAGTCGTTTACGTTGACCTGACGAGATGCCTTTGTGAAATACATCACCAACATTTGCGTACATACAGGAGCGTAATCCC
ATTGCATCGATCACGTCTTGAACACGAGACTCACGTGTAAGAGGAGGCACGTGACTAGGTAGTCCTAGACCTGCTGCGATCTGTAGAGTCTCTAGAACGG
AGAAAGACCCGAGGAATGCCATATCCTGTGAAACGTAGTTCATGATCGAGTGGAATGTGCGCGAATCTCGAGGGTTACCGTTCACGTTTACGATTCCCTC
GACACGTACCCCTGGTCCACCAGGGGGTACACGATCTGCTAGAATGTCGAGTAATGTTGTTTTACCCGCTCCGGACGGACCGATGATAGCGGTCAGGTCT
CCAGGCCCTGATCGTCCCCAAACATTGTTTAGAATCTTGCGAGGCTT