Description :
From Genome Similarity Track
Location :
contig_7:101626- 104062
Transcript NameFunction/comments
g2476.t1hypothetical protein

Sequence
2436 bases(100 bases per row)
GTAACATCTAGAATAGTACTACACACTAATAATAATTCTCTGAAATAAATTTCAGAGATACATGCACACCATTTTTGACGACTCCAATTTTATACTTCCA
GACCGAATTTCGGGAAACTGAAAGTATCATCGAGTTTGTTCGTGTCGCAATCATAGCGCACTTGGTTTTAATGAGGTCCTCTATTTGTGTTTACCTGGAA
ACTCTAGATCCCTGACAGTCGCTGGGGGCGTCGAAGCCCAATATCTCTGTGGGATTTTAACCCAATGTTGATGTATCGAAGCCGTGGTGAACGGCAGATG
AACTTTATGGAAGCAGGAGGGTCACCAAGACCTCCCGCCACGGTGGATCACGATAATCGAGCAACACGAAGGCTCCACCAAGCCCCCCCCCCCCCCCCCC
CCGTTTAGGTGGGCAGACTTGAACACTTGAGGGTCACCCGTCCCCCGTGGTTTGGTGCTGGATCGGAATCGCGCCGAGGCACCAGTTCCGTCGCAATGTG
GTGGGAAATCTTGATCACAGGAGGGGTCACCATGCCCTCCGCGCCTTGGTACTTAAGCAGCTTGATATAAGTCCTTGCTCTCCTCTTCCAACTGTCCTTT
GAAGTCAACACACTTTATCGAAGCAGGCTGAACTGGCTGGGGCACGTGGGAGGATCGCAGATCCGCTGGCACAGCTTCCGGGGGTTAGTACGCGTACCTT
GAAAAGTGTCTAGGGCGGTTGCTTTGCAGCTAAGCACATGCCGCGCGGGGACAGGGGGCAGAGGACCCGGCGTCTGGACGAAACATAGTGCACTTGTGTA
TCGAGTATCTAAGAGCTAGGCAGGTCAAAACAGACTTTAAAACCGACGTTAACTACCGGTAGCCCCTTATGCCAACACAGATGCAACGCATACTATAATG
AGCTTGCAGTCTTGCAAGTGTGAGGGTGTATACATGTACTAAAAATAATATAATAGTTTGAGCGCCTACGTTCTAACACGCCTGTAAGATAGATATTGTA
TTAACCCTTTCGTGAACGCTGGGTCTTCACTCAATTAAAGTATAATATACAAACCAAGATGTTAAGCTGTGAAAGGGGGCATTTTGCCCCCTTTCATAAA
CCACGGTACTCGCCTTAAAACAGTCCTTTCTGGATAGTGGAAGGAGGATGGGATTTAGGAGGACTAGGTCGCGAAGTTATGATGAAAGGGAGCAAAATGC
CCCCTTTCATACGCCACGGTACTACCCCACCTGGCAGCTGGTCATTTTGCTGATTGGTCTAAAAAAAGGTTTCCACCGCTTTTCTGACGATCATGACACT
TGAATGGCTGTTCGTCCGACTGGCGTGATGGCATAAGACGGCAGATCTTGAATCAGATCCCGAAAGATATCAGGTCCCACTTGAAATCTATCGGCGTCAG
CCATCCGTGTGTGAGAGAGGACAAGAGTGTCCTATATGCTACCGAATTGCATGAAGTAGCGAAGACCGACACCTGCACCAGCGATCGCCGTACTGTTGGC
GACCCTGCACAGATAGTTCTCTTTTTCACGAGTGGAGTGTGCGAAGTGCGTAACTTTTCATCACCTACTGTACCAAGCTGGCTGTTCTATCAGTAATATG
CTCATGGCTTCAAAACGGCGAGTTATGCATTTATCTTGCTTTAACTATGCAAATAGCGGCAGCTGTTGACGATCGCAATTGACTGTTCAGTCTCAAGAAC
ACCTCCGACGAACATGGAGAGTCATCAGAGTGATAACTTAGGCGAGGCAGCGCCTGGTGACGGCAGTAGCGAGAGCGAGAACCTCGGGCGCTTGCTCGGG
CAGCGTCCGGCGGCGGCGGCAGCGAGAACCTTGGGCGCTTGCGTCAGGCAGCGGTTGCTGCAAGCGGCAGTGCTTGAAGCGATGGCAATACTCGGAGCCC
TAATGAGAACGCAACTGGAGCTGCTCAACGTGTTGTTGAAGTTGTACCAGCCATGGAGAATGCCGAAGGTGGTCCAGCGTCAGCGCCGAAGCGAAAGCGG
GGCAGACCGAAGGGCTCAAAGAATAAGCCAAAGACTACGACCGACAGTGAGCCTGCACGAAAGCGCGCCCGTCCGGCAAAGTCCAAGGCTTCACCGAAGC
GCAGCCTTGTGCAGGCACTGGGTCAAGCTCGTGACAATGTGGCTCCCTCGACAGAGAGTGTATCCCTACCAGGAGAAACCTCGGTCGCCGGCGCCCCTAC
GACATATACTGCTGACAGCGAGGCCAGCGTTCCCTCAGCGCGTACCGGCACCGTTCAACAAACAGATTCACCAGCGACTCCATCAGCTGGAACGCGTCGA
AACAGTCTGGCCCGACCACCACCCATTCCGGGATTGTACGCAGACACACTTGTGGCATTTTCACCAGATAAAGAGGGCTGGACAAAACGGAAGAAGACCA
AGGACAAGTATGCGTGTGTCGGCAGTGCGTATCTTG