Description :
From Genome Similarity Track
Location :
contig_7:101603- 104045
Transcript NameFunction/comments
g2331.t1hypothetical protein

Sequence
2442 bases(100 bases per row)
GCACATGTAGTAACATCTAGAATAGTACTACACACTAATAATAATTCTCTGAAATAAATTTCAGAGATACATGCACACCATTTTTGACGACTCCAATTTT
ATACTTCCAGACCGAATTTCGGGAAACTGAAAGTATCATCGAGTTTGTTCGTGTCGCAATCATAGCGCACTTGGTTTTAATGAGGTCCTCTATTTGTGTT
TACCTGGAAACTCTAGATCCCTGACAGTCGCTGGGGGCGTCGAAGCCCAATATCTCTGTGGGATTTTAACCCAATGTTGATGTATCGAAGCCGTGGTGAA
CGGCAGATGAACTTTACGGAAGCAGGAGGGTCACCAAGACCTCCCGCCACGGTGGATCACGATAATCGAGCAACACGAAGGCTCCACCAAGCCCCCCCCC
CCCCCCCCCCCGTTTAGGTGGGCAGACTTGAACACTTGAGGGTCACCCGTCCCCCGTGGTTTGGTGCTGGATCGGAATCGCGCCGAGGCACCAGTTCCGT
CGCAATGTGGTGGGAAATCTTGATCACAGGAGGGGTCACCATGCCCTCCGCGCCTTGGTACTTAAGCAGCTTGATATAAGTCCTTGCTCTCCTCTTCCAA
CTGTCCTTTGAAGTCAACACACTTTATCGAAGCAGGCTGAACTGGCTGGGGCACGTGGGAGGATCGCAGATCCGCTGGCACAGCTTCCGGGGGTTAGTAC
GCGTACCTTGAAAAGTGTCTAGGGCGGTTGCTTTGCAGCTAAGCACATGCCGCGCGGGGACAGGGGGCAGAGGACCCGGCGTCTGGACGAAACATAGTGC
ACTTGTGTATCGAGTATCTAAGAGCTAGGCAGGTCAAAACAGACTTTAAAACCGACGTTAACTACCGGTAGCCCCTTATGCCAACACAGATGTAACGCAT
ACTATAATGAGCTTGCAGTCTTGCAAGTGTGAGGGTGTATACATGTACTAAAAATAATATAATAGTTTGAGCGCCTACGTTCTAACACGCCTGTAAGATA
GATATTGTATTAACCCTTTCGTGAACGCTGGGTCTTCACTCAATTAAAGTATAATATACAAACCAAGATGTTAAGCTGTGAAAGGGGGCATTTTGCCCCC
TTTCATAAACCACGGTACTCGCCTTAAAACAGTCCTTTCTGGATAGTGGAAGGAGGATGGGATTTAGGAGGACTAGGTCGCGAAGTTATGATGAAAGGGA
GCAAAATGCCCCCTTTCATACGCCACGGTACTACCCCACCTGGCAGCTGGTCATTTTGCTGATTGGTCTAAAAAAAGGTTTCCACCGCTTTTCTGACGAT
CATGACACTTGAATGGCTGTTCGTCCGACTGGCGTGATGGCGTAAGACGGCAGATCTTGAATCAGATCCCGAAAGATATCAGGTCCCACTTGAAATCTAT
CGGCGTCAGCCATCCGTGTGTGAGAGAGGACAAGAGTGTCCTATATGCTACCGAATTGCATGAAGTAGCGAAGACCGACACCTGCACCAGCGATCGCCGT
ACTGTTGGCGACCCTGCACAGATAGTTCTCTTTTTCACGAGTGGAGTGTGCGAAGTGCGTAACTTTTCATCACCTACTGTACCAAGCTGGCTGTTCTATC
AGTAATATGCTCATGGCTTCAAAACGGCGAGTTATGCATTTATCTTGCTTTAACTATGCAAATAGCGGCAGCTGTTGACGATCGCAATTGACTGTTCAGT
CTCAAGAACACCTCCGACGAACATGGAGAGTCATCAGAGTGATAACTTAGGCGAGGCAGCGCCTGGTGACGGCAGTAGCGAGAGCGAGAACCTCGGGCGC
TTGCTCGGGCAGCGTCCGGCGGCGGCGGCAGCGAGAACCTTGGGCGCTTGCGTCAGGCAGCGGTTGCTGCAAGCGGCAGTGCTTGAAGCGATGGCAATAC
TCGGAGCCCTAATGAGAACGCAACTGGAGCTGCTCAACGTGTTGTTGAAGTTGTACCAGCCATGGAGAATGCCGAAGGTGGTCCAGCGTCAGCGCCGAAG
CGAAAGCGGGGCAGACCGAAGGGCTCAAAGAATAAGCCAAAGACTACGACCGACAGTGAGCCTGCACGAAAGCGCGCCCGTCCGGCAAAGTCCAAGGCTT
CACCGAAGCGCAGCCTTGTGCAGGCACTGGGTCAAGCTCGTGACAATGTGGCTCCCTCGACAGAGAGTGTATCCCTACCAGGAGAAACCTCGGTCGCCGG
CGCCCCTACGACATATACTGCTGACAGCGAGGCCAGCGTTCCCTCAGCGCGTACCGGCACCGTTCAACAAACAGATTCACCAGCGACTCCATCAGCTGGA
ACGCGTCGAAACAGTCTGGCCCGACCACCACCCATTCCGGGATTGTACGCAGACACACTTGTGGCATTTTCATCAGATAAAGAGGGCTGGACAAAACGGA
AGAAGACCAAGGACAAGTATGCGTGTGTCGGCAGTGCGTATC