Description :
From Genome Similarity Track
Location :
Scaffold_257:1016- 2815
Sequence
1799 bases(100 bases per row)
CTGGTATAAACAATCGGACATCAAAGCTCGGCACCAGCGAAATTTTCCCACAGCAAAGGTTGAAGGAGCAACACAGTGAATATTGCGACATCTTTGACAT
TCAAAGACGAAGGAGCTGTTTACTGAAGGCTGGAATGCAATGAAAGGTCATATACCAACGGTATGCGTAGAGTATATCCAGAACCGCTGGATTAACTCGC
ATAAAGCGATGTTTTTTGGCCCATATATTACTCAGGTTAAGCACTATGGGCAGATTTTTTTGCAAGGTTGAAAGCGCTCTGCTTTCAAAAAATCCTTGGG
CACCTTCCAACTTGATTTTTATTCCAGTCTATCCAATTATGAAGACCGTCTGCCGCAGTCAAGTGGAAAACATTTTTCTTTTACGATTATGCGACAAAAT
GTTTTTTTCCGGTCGTTCCACGCAACGTTTCTCGCAACTATATGGGTATAAATCAACTTGAGCACTAAAACTAATGAACCGGGAATACTTGGCAGCGGAA
AAAGAATTATCAAAGAAGTTGAATACCCTACCGAACGATTGTGACTTGGTCAAATGTAATGGTCTGTGTATGTCCAATTTTAAGCTTTGCTGCAGACCCG
TTCTCTTGGAGTTGATGTTATGCGGTAATGGAGTACAAGGGCAAGTCAACCCTTCGGATATCGATGCATACTGGTTTCTGGAGAATACATCTCTCCAGGA
GACATATTAATTGTACGCCCAATACTTCCTCCTCTCGCAAAACGCAGAGTAGTCCTAAAAGATTGATGATAGCAGAAGAAGTGGCCGAAAATGAAGCAAA
GAGCAATCAAATACGCTGTAGATTTTGTAAATTCTACGGCCACAAGTTCAGTTGCCAGGCCAAAAGCAAAGCCGCTAGTAACCAGGCCGTCTGAAAAGAG
AAGCAACAACAACATCGGATTTTGCTTGCGTAGTTAAGTAACAGCAGCACATCGAGTCACCCTGAAAACTATATATCGTTGTCGCACAACCCTTAAGCCA
CATGCACGCCACTCATGCCTCCCATTCAGATGCTTTCTTCAATTTTAAATGATCCAATTAGGGTGACAGCTCCAAGAAGTCAATGCTACCAGCAAGATTA
CATGATTCAGAATAAGCTGGCATTAAATTTGAGTAACGCCCCTTAACGTCTAGCAATACAGTACCCAAGACCATCCCAACTGTCTTATATACCCCAACTT
TTCCTTTACCGGGTGGTATTAATGACAGGGACCAAGATACTACGAACCTCAACCTAAGTCCAGCAAACCCTTTCACCTTCTCGTGATGAATGTTTCTTCT
AGCAGCAGAATTTATATGAAAATGGTATTTCCCTTAAAACGCTCGACAAAGACACTGGTAATCACATTTCCATCTGTGCACCTGAGATTTTTATACTCTA
GTTCTATTAGATTTAGAATTTTCCTTACGTAGCCTTTCATTATTATGATCATAATTATTTCAACTCTTTCTTTATTCCGTTGCATTAGTTATTGTCTTTG
TCTAAAGTTAGTTGTAGCAGCAGCATTGGCGACAACTACAAGAGACGTCTATCCGTAAAACGGCGTGGGAAGCACATCAAAACCGGGCGTCATACGTACA
CCTACTTGTCATCTCGCTGTGATGTAGGGCCTTCAAAATGCTCCCATACATGCTTTATAGTTGTATCGTGCGCCTGAATCTTCACCGTCTTGTTAGGCGG
ATCCTATGAATCGGTATAAATCACTCCAGCTTCATGGAGTCGGGTAGTCCACGTTTTCATCATCGGGTGTGACGATACGGAGATGACGAGGTGCAGCTG