Description :
From Genome Similarity Track
Location :
Scaffold_42:1016- 2381
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_42-fgenesh-gene-0.2Zinc finger family protein

Sequence
1365 bases(100 bases per row)
TTCTGGAAAAGTCTAGAAATAGAACTCTCCAGAGCAGCCAATCAGCGCGGTTGGCGACCTTTCGCTGGCCAATGAAAGTTCTCAAATGCCCATTTCCAGC
CAATCACGCCTCAGAAGTACAGCCTTTCAGCTTCCACATCCCTACGTACTTTCGCATATCCAATTGCTTGTCTCTTCTCCTTCTTCGTGTCTGTGTCAAC
ACCAACGACACGAATACGCCCATTGCTCTCATTGCCATTCTGCAATCTACTCCCAGCAAAGCAACACCAGCAACCAAGAGCCAAGAGCCAAGAGCCTATA
GCCTATAGCCATAGAAACACATCAGTAACGATGTTCCCAGCGCGACCACCGCAGCAACAACCAGCTCCTGTCAGCAACAGCAGCGGCAGCAACCCATCAC
CAACGACCACGCGCAGCTTTACCGCGTTCCTGGTACCGCCACCGATGACCGTGTTCGTACAGCTCAGCGACGGGCTACAGCTGCAGTTCACGCCATCGCC
CGAGCGCCTGGTGAGCTCGTTCATGGGCGGCGTGCCAGTGATCTTCCCGGTAGCTGGGGCTCCTTCCTCAGGTGGCGGCAACAGCTTCTGGACGGGCATG
GAGAACGAGGCCATGATGCGCGCGATGCACGAGCTGTTTATGCGCAGCCAGAGCGAGCAGCGCGGCCCGCCGCCGACGAGCAAGTCCTTTTTGGAGAAAC
TGCCGCTCAAGACGTGGAACAAGGAAGTGTGTGCGAATGAGAAGTACACGGACTGCGCGATCTGCCTGAGCGAATACGAGACGGACGACACCGTGATCTC
GTTGCCCTGCGGCCACGCGTTCCACAAGGACTGCGGCATGCCCTGGCTCGTGGAGCACAATGTATGTCCGACGTGCCGCCACCAATTGCCGACTGCACAG
GACGAGTCGAACAAGCCTGCGACTACTAGTTCTACAGGTTCGGATGACAATAACAACAACAGCAACAGCAGCCGAGATGCCCAGGAAGGTGGTGGCGAGC
CAGATGAAGAGCCTGAGGGCTTTGAACAGATGCTGCGATCGCTGTTGGGAGTGCGACGACCGCGCTCACCAACGATCTCAGAGCCACAGCCAGCGCGCGT
GGTGCGCCAGCGCGTCGAAGAGCGCGAGCCACTTCTCCCAGGTGCCGTACCATTGGATACCAGCAACAACGATGGCAACGACGATGACGCCATGCTCGAC
AGCATGCTGGAGGAAGAGGCGAGCCGCTTTGTCGAGGAAGAGAAGGTCAAACGGGTAACGCAAGCGCCAACTGATACTACTTCAGCGAATGACGCTGTGC
TTTTCGACGAGGTCGACCTCGAAGAGCTCCTTCGCGATACCAGACCACTCGCCAACTGCTCAGCC