Description :
From Genome Similarity Track
Location :
Scaffold_1794:1016- 2120
Sequence
1104 bases(100 bases per row)
GCTGCTCGTCATGGCTAATCCACCACCGGCAACTTGCATCCGTGCCACCAACCCAAATCCTCTCTAATCACTTGAAATTGTCACTGATTCGGGATAGTGA
CCCCGCGTCAGGCCCATTCTCTTATTTCTGAGAAAGCACTTCACCACAGCTGCGCCGGGGGCAAATTCGCGAACACGGGGTGTTCCATCCTCGCAGAGGA
TATAGTCAACCGACTCAGGAGCGGGTTTGACTACAAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTTAGCGTCAGAGGAAGACGTTCGACTCAAAGA
GTCACTAATACTAAGTTCCTTATCCAAAGGAACTTACAGCCCAAGACCAGGGCTCAAAGTTAATACCTTAACTTTTATGCTTCAAAACCAGAAGTGTTTT
ATTTACTATTATTGCCGCCTAGGGGTAAATGAATCTGTTTAACTATCTAGCATAGTTAAACCTAATCAAATGCATAACGTGTGGCTTTCGGCCAACGTAC
TGAGAGACCTTGTTAACTCTCCAACTTATGTACTGAGAGTTTGTTAACTATCCGGGTACTTCGTACCCCTGTGTGTTCCACACTATGTAACCCCGTTACG
GGATCTGTTTACCGGGTACGTGATAGCCAAAGCTAGTGCGTCTAGAACGGCACAAACCATTGCCGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGG
GATAGTGAGATGATTAGGCATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGG
CATATCGTCCCCAAGCTAACGGGTCGGCCGAACGCATGGTACAGATGATCACGAGGGCACTCAAGATGTATGTCCAGGATTTGGATCAGAGGGATTGGGA
TGAGTACGCAGAACGGCTCTACTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCCATTTTACTTGGTACATGAGTGGGATCCCAAATC
CACCCTGGAAGCGGCCATCCCAGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCCAGA
TCCC