Description :
From Genome Similarity Track
Location :
Scaffold_78:10159- 18088
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_78-snap-gene-0.19Myb-like DNA-binding protein
Pytir_DAOMBR486maker-pir_contig_78-fgenesh-gene-0.2Intraflagellar Transport Protein 57
Pytir_DAOMBR486maker-pir_contig_78-snap-gene-0.31Anaphase-promoting complex subunit 10
Pytir_DAOMBR486maker-pir_contig_78-snap-gene-0.21Conserved gene of unknown function

Sequence
7929 bases(100 bases per row)
AGGTGTTGGCGCCGGGGCTTGTCAAGGGTCACTGGTCTCCTCAAGAAGACGATTTGCTGCGCCGACTCGTTGCAAGCGAGCAAAAGAACTGGGGTGAAGT
TGCTGCGAAGATCCCGGGGCGAACATCCAAGCAATGCCGCGAGCGCTGGCACAACCACCTCGACCCGAACATTGTGCGCGGGGCCTACACGCCGGAAGAA
GATCGCATCATTCTGGAAGCCCAGGCTCGCCTTGGCAACCGGTGGTCGGTGATTGCCGCGATGCTTCCAGGTCGCACCGAAGACGCCGTGAAGATCCGAT
GGAAATCGCACTGCCGAGTGTGGCGAGCGCGCAAGTATTTAAGAAAGTCTCCTTCGGACCAGCCTGGCGGTGAGGACCATGAGCAAGACGATGAGGATGA
CGACAGCAGCGACACGGAGTCGCTCTCGGGGATGGAGACGCCGCTGGCGATGACGCCAATGACCCCAGGATACGGCCACTCCTTTGCGTGGCCGACCGCG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGAGCAACAATAGTAGTAATAGTAGCAGCAGCACGAGCAGCACCACCGCCGCCAGCAGCAAGTCCAA
GAACAAATCTGGAACAAGCAGCAGCAAGAGCACTTCGGGAACAGGCGATGAGAGTTCCATGGCGGCTGTTGGCGAGAAACGGTCAGTGCGCGTCCAGTAG
CGTAATCGAGAGAACTCACTTCAGGCCAAAGGAAAGGCAAAAGGGAGTAGATGCTGTTGTAAATATCTCGCTCGTCTCCATCTCCATCTCTCTCTCTCTC
TTTCTCTCTCTCTCGTCGCCTTTTTTCTCCATGGCTGGCCTCGATTTATGCTGTTTGAGTGAATGATAATGTGAACAAATTTGAAAGTAGTAAGTGCGTT
TGTTTCTGAACCATTTTCCACTTTTGTTGTCATTATTTTGTAAACCCTCGCAGTCAGAGTCGCGTCGGTTCGCGTCCCCATCGGTGAAGCGGCAGGGGAG
CTTTGAAGCGCAGTGTTGAGAGGAACAAATAACTCAACCGTCCATCCAATAGTCAGCGACAATGGCAGACGACGCGGAAGAGCAGGACAAGAACAGCAAG
GGGGAAGGCCAGGAGGTCGCCGCGAGAGATGTAAGTGAAGTGGCTCACGAGTACTCTGCAGTATGGTCTCATTGCATCCAATCTCTTTGATCTAACAAAC
AATGCAATCGTATAATTCCTCGTTGGCTGCACTTTAGGATGTGAGCGTGACGCTCATGGGGAACGTGCTCGAGAAGCTCCGCGCGCTCAACTACGAGCGC
GAGTATATCAAGAAGAAGGGCATCGCGCCGTTCACCGAGACGCAGTTCGCGGTCATGACGTTCAGCAACCCAAAGTAAGAAAGGCAGACCGTTCAGTCAC
TGCATACATACTCGCACTAAGTGCCTGGGTTTCTAAACACTCGTCCTCCGTGTTATTAGTGTGCAGTTTACGAGCTTCATCGACCTGATCCAGTACTTGA
TGAAACAGGCGAACCACAACTTTGTGCTCGACAAGTACGACGACCCGAACACCAAGATCAACAAGTTCATCCTGGCACTCAAAGTGCTGGGCTTCCCTCT
CGATTTCCCCGCGTCCAAGCTGCGCCTGAGCTACGGCGAAGCCGCGTGCGCGGCGCTGGATTTCATGTGCGACAAGGCGCTCGCTGCGCGGAACTTTGGA
TGGACGCGGCCGAGCTACCCGAAAGAGGACTTTGCGGACGAAGCGGAAGTGGACGAAGACGCCGAGGTGGACGCCGACGAGGACGTCCCCATCGAAGAAG
AGGAGGAGCTCTACAGTGACATCGCGAGGGAGAAGAGCGGTGAGAAGGACGAACTGGAGCAGTCGTTCCAGCAGATGATCATCAGCGAGGTATAAAAGCT
AGAATGCATGCAAGAGGCTGGTGCTACAGCTCATGACAAATAACAATTTTGTGATGTGATGTGTTGCGATTAGGTGGACCCTCTGCTGTGGAAGACAGAG
CTTGAGCGCGTTGGCCCGAAGCTCAAGCTGCGCGTCAAGGAGGACGACGGGAAGGAGTGGCACGCGCATATCGAGCGAACCCGGAAGCACGAGACTGTGA
GTGAATTGGTTTGCCATACATACAAAATTGTTCGTTGTTGAGCTGAGCTCAGAGGTTTGCGTGCTACTTCCTAATTCGTCTCTGGGGCTACTCTTTCAGA
TCATCAAAGAGCTGCTGCCGTTGGCGAACAACCAGCTCAAGATCATTGGTGGCCAGCTTGCTGAGACGATCCAGCGCATGGGCGCGAAGGAGAAGCTCAT
CAACAATCAGTACGAGGACTTACGCCAGGAGTACCACCAGCTCAAGGAGAAGCTCCAGGTGATCTCGGATCGCTGCAAGGAAGGCTCAGACAAGGTGAAC
GTCATGACGAACGAGCACGCGCAGATCACGGAGCAGCTGCGCGAGACCAAGGCCGTGATGGACGACCGCGGCAGCAAGATGACTGACACGTCGCCGCTCG
TGCAGATCAAGGAGGCGCTCAAGACGCTTAGCGTCGAGATCAAGAACTTTGACCTGCGCATTGGCGTCGTCAGGTACACAACAGGGGGAGGATTATTTAT
TGGTCATGTTGGAGCATGGGTGACAGAACTAACTGAATGGGACCCCGCTTACCATTTATGAAATGACAGCCACACGCTGCTGCAGGCGAAATCGAGGCAG
GCGTCCTCGGCGTCCCGCCGCAAAGCCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNTACCAGGACCCCGAGTACGATCAGAGTGACGAAGACTCGAGCTG
AGAACGGAACGAGCCGAGCCGGAGCTGCATCCCCTCCCCTCCCCTCCCCTGACCCGATCCGACCACTGCGTTTAATCAACCGAATCGAAAACAGTAGCGT
ATGCGTTCGCTCACTTCTCCTCGTGTCCCTCCTGGTTCCTGTTCAGAGCATGGGATTGAACAACGTGTGATAGATACACCTTTGGCGGCAGAACACGTTG
TTATATAGTATGGCGTGCACTTGTGCCATATGTCTCTGTCGCAGCAGTAGGTTCCTTATCTACCATCGATCTGCGTGGAATGCTCCGTAGGGCACAGCGT
GTAGGTGAGCACTCGACGATTCTTGTCTTGCGGAACGTAGTGAGTGTCATGATGGCATGCCTCTGAAATTTGCCTGGTCGGAAAGTTGTCCAGGAACCCA
AAATAAACTCAGTAACCCAAAATCAGATGTGAGGAGGAGTGACGGTCCCTTTGTTGCCTCTCGCCTCTCTTGCTCCTCATCAGCACCAAGAAAAGCCGTT
GAGAGATGAGAAATGACGAGAGAAAAGCAGACTCTCACCCGCCCCCACAGACCAAGAAAGAGCGCTATCTGGCACTAGTACTCCGTCAGATGGGTATTGG
TGTCGTGTATATGCGTACGTGTGTTCGTTTTTTTGTGCGCATTGTTACATGGGCTGCGTCGAAGGACTTCTTGCGGAGAATGTGACGCTTGAGATTGTTT
TACTTGTGTAGCTTGGCGGGGGACCTTACCCATGCTTCGTTTTGTCTTTTTTGCCAGTAGTATAGAACCCCTTCTCTTGCAGTGAAGTCGAGCTCGCGAG
TGACACAGCGCCACGCAAGCGGATGAAGCGAACCAATGATGCTCAGGGTACACCCCGAGCGTCACGTCCATCGATATCGAACGCTGATATGCCTACGGCT
AGTGGTTCACGGTGCACCATTACCTCCGCAAGCCCACTTCACAGGACGGGTGCAACACAAGCACAACAAAGCAGAAGGATTGCGACGCCTCGACCCCAGT
CGGCTTTGACCCCAGGCGGCAATATGCCCACGGCAAGCCCACCGATATTCAGACTCGGCGCAGCACCTCCTCGCAGGGCCGAAACACCACTCCAACGGCT
CAATAGAGTCAACGGAATCCGCACGCCGTTGACCAAACCCAAGCTTTCCCAGTCATTTCAGTGCGTGAGCACTGCTTGCCCACCGCGGACTCCCAGCGAA
GCGTTCCTGAGCCCAAGCTTTCGATCGCGATTTTCTGTTTCTGTACGGTCAGCAAAGCCACCAATGTCGTCCGCAAAAGCAAAGCTCGACTTCTCTAAAG
TTCAGCACTCGGTTTCTGCTGCCCCGTTGAAAAGTCCAGCTTCGACGATGAACCAGCCAGCAACGCGGAAAGAAAATCCAAGGCTGGAGGTGCTTGCACG
GCGGATTCAACTGTGTATCGACGAGAGGCGATGGCACAACGCGATGCGAGTGATCGAAGAAGCGCTGCACCAAGATTCCAAGTCTTCGATTTTGCAAATG
CAAAAAGCACTGGTGCACAGCCACATTGTGTAAGTACCATATATTTCGCAGACATGCCTGTCGTCCATCTACTTATCCGGTCAAAATGTAAACTTTCACC
AGCGCCGAGACCAGCGTAAGCAGGCGCCTCGACGCGGAAGCAGCGATGAAGCACCGCCGAGATACAGAGCGAGCTCAGCGAGCCCAACATATTCGACAAG
ACTTCGAGCAGAGCCGTCACAGAACGTTTTACGACGTTTTGAAAGTACGCAGCAGCGCAACTGGCGACGAGATCAAGATTGCGTATCGCATGCTGGTGCG
TCAGTATCATCCAGGTAGCAAGACACGCACTGTTACGACAGGCGTTGGTGGATCTACAAGACTTACCTGGTGATCTAACCCTTCTCTTTTGCGTAGACAA
AAACCAGAACACGACCGGAGGCGACGAGATCAAATGCATCACTGAAGCTTACCGAGTGCTCTCTGATGCCACTCAGCGAAGAAACTACGACGCGACAATT
CACACTAAACGCATGTGGCGTTGATTGTCGCTCCCTTCACCCGCTGTTTGGTTCATTTCTTCGCTCAACAGTCAATTTAGCACAGTTGGTCCACTCGCAA
TTAGTTATCGTATTCTTCTCACTAAAAACCAAGATCAAGTACTTTTAAATTAGCGGTCGCCACCAGCAGCAGCTCGTGTCACCTTATGCACGAAAATGCC
CAAAACTGCTCGGTCGACGGCTCTGGGATGGATCGGTCCAGCACATTCGGCTCCCTTGGAGCGTATACTTTCACTTGCCGAATATGCGTGTCACGACCAT
TCTGGTGCATCGCGACGATCGCCACCTGCAAGAAAAAGGTTCGCAGAGGGATCTGCTGAACATACGCATTCACAGCAGGACAGATGCACAAATAGTCAGT
AAAAGCCAACACGCACAACCAAATACAGCTTTGATCTCTTCTCACCTCGTCTTCTTCGTCGGAGACACTCAGCGGGATCGTGACCCAGCCGTTTGGCTCG
GCAATGCTCTGCGCGTGGATCTCCTTCAAGTCGTGCACCGTCGAGCCGCAGCGGATCGATATTTTCTTGGGCGTGTAACTCTCGTCCAACTTGTAGTCCA
GATAAAGCGCCACTTCCTTCAGCGTCATCTTCTTGTGGAACTGGATGTTGATCAAGTGCGGCTGGCTCCCGTCCGACTGCCAATACGTGTCAACATTGTC
TGCAGTTGGAGATAGAAAGAGAGTGAGTGAGCATGCTGTCAGTACAAACGCTCACATGACTGCGGGTAGTATCGCGAGCGCTCACTGTCGCGCAGCTGGT
CGACACCGTTGCCGGGCTTGGCGGTGGAGAGCGACCAGACGGCTTCGTCGCCAACCTCTCGGCGCGCATCTTCGTGCGCCATTTTGACTGCCTTCCCGCC
CTTTCGAATTGAAGCAGCAAGGAGTATGAAATCGATACCCTCCTTATTTTTAGAAAAAGAGGTTTGCTATCCGCATTAGAATTCGAAATAGAATGAAATT
TCAGGTCATTTATAGGTGAAGTCGGTCCTCTGATTCCAACCATACGTTCGGTTTAAGATCGATTAGAATGTAAGCTTTACAACAGCCTGAAAAATAGGAC
AGTAATTAACTTCATATATTTGGCCAATCAATGATTCGATTTACGTTCTGAACGCTGATTGGTCGAGCGCTTCAGTATCCAAGTTTCTTACAAACAACAA
GTNNNNNNNNNNGGAAGCGCTCGACCAATCAGCTGCGGCTGGCTTCAAGCAACCTCATTGGATATTTACCCAAAATAACATCGTAGCATCCAAAAGAAAG
AGCGCCTTACTTGTTTCCCACTCTTTCAAAAGTACTGGACGAGACACAATGGTTGAGAAGCAGGTCGCACGAAGGTAACGTAACGAAGGTTGTACTTGTG
TGCTGTTTTGCGCGGGGTTTCCTTTTGAAATTCTACTAACAAAAAAGCAACAACGGAAAAAAAAATGGAGAAGAACGAGACGGCAGCAGCACTCAAGATC
GCCGCTGCAGACGCACTAGCTGGCAGCGTAGACACCCACCACCAGCCGCAGATGCAACTATTGGAGCTACCGACAGACCACCAGAGCGAGATCGATGCGC
ACAACAATGATGTGGACTCCAGCCTCGAAAGCGAGCGACAGAGACGACTCGGGTCCTTTGAGCTGTTTGATGCTGCAATGGATAACGTTGTCGAGCACGA
CGGCAACGACGACATTGAAGAAGAGCATGTGATGGTGGAAGCGCCCGATCACGACGCTCAACCGGCTGAACGTGAGGCAGAGCGATTGAATGTGCATGCA
GCGGGTGTTGGAAATGTCACTGAGCCTGCGAACAACGTCGACGTTCCTCAGAACACCGTTCAGCCCCAAGAGAGTGCAGAAGATGTCAGCACTTTAAGTG
AGAACGCGAAAACGCAAGCGCATTCGGCACTGATGCTGATGGACTCTCGAGAAACGACAAGCGAGCTGCATTCAGCAAACGAGATCGCAGCCACGTCCCA
CGCAGTGACAGATATCTCAAGCTCGTCTTCGTCTGCAACTACGAGTATTGCTACGCATTTTGTTCCAGACGAGACGCCAGCGATCCATGAAATAGTCAGC
GGTTTTGAGAAGTATGAGCCTGAGTTGCTGCAGTGGATTCAAGCGTGTCAATCTGCGGATCCGGGTAAGAAGCTCTACGGATTTACACATTTGATGGGCT
CACTCGAAAACTAATGCATTGCTTTATGTACACATATATCTGTGTCATTACAGGGCTCCCAGCTTCCCAGGACGATGTGCTGATGTTTATCGAGTCGAAG
TTCCCCGAGCTTCTTGAAAATGTCGCAACACTGTTTGAGTGGCTGAGCCAATTTTTGGCAATCTACAATCGAGTCGAGACACCAAGCGTGCTTCCTGATT
CGGATCCATCTGGGATCAAGCACTTCGATCGGTTCCCAGAGGAATTCAAGCTCGGCGCCATTCAGCGGCTTGAAGAAACAGGAAATTTGGCGAAAGTTGC
AAACGAGTTCGGTCTCAAAAGCACAACCACGCTGGTGTATTGGAAGTATCAACGAGATGAGGCAGGTCAACAGCTGGCAACTCGTAGCCATCTCATTGAG
CACGGACGGAAAGCCGGATTTGCTCAAGAGCAAGAGCTCCTGGAGTGGGTGCTGTCTCACAGAGAGACCCCGATTACGAAACAGGACATCTTCAACTACA
TGGTTTCTGCCTATCCAGAGTACGCGACGACGAGAACAGCAGCAGCGCTGAAGATGTGGATTGCGCGCTTTCTCAAGAGGCACTTGTCGCCAGGAATGTC
TTCGTCGTCGAAAGATTCGCTCGCTGCATTACCTGCTCGTGATGAAATTGAACCGGAGCCGGCTGATAACCTCGCAGAGCCTGCTGCTGCGACTGCCAGT
CTACCAGATCCAGAAATGGCGATGTCTACTTCTCCAACAATATTTACAGTAAAGCCACGAGTGGCGTCGTCTCTTCCATCCTCCACAAATGGCCAGACGA
GGCGGCGAGAAAAGAGAGGCTGTCCTGACGGATACGTGCTTCACTCGAATGAATTCAAGCTGAACGCATTGCGGAAACTGGACGAGGGCAAAACCATGAG
CGAAGTGACTGAGGAGCTCGGTCTGAAAA