Description :
From Genome Similarity Track
Location :
Scaffold_180:10156- 13460
Sequence
3304 bases(100 bases per row)
AGAGTATAAGGCCAGGAAAGCGGTCAAACAACAGCGGGAGTTAGCTCCTGAATCTAATGTATCTGTCCTACTGATCGTAAATTAACACGAGCGGGATTCG
CCCTGTAAGCTCTGCGCGCATACGCGCAATCCTAGAGCCACGGCTCTACCAATCGACAAGCGGTGACCTTACACCCCGAATGCCGTTGCTGAGCTAGCAC
ATCAACTCAGAATTCGCCCTGTGGTCACACCGGCAACATGCAATTGTCTCGCCATGTCGGTACCGCAGGATGCGAATATAAACGCCCCAGACCGGTCTTT
AGAGCTACTAGAGACTAGCATAAAGTGTGGCATTAAGTACTTGGGTCGGCTAAATCTCAAAAGCAGCTCGCCCATGACCATAGGGTGCATATTTTACAGA
ACTTTCACCGCGGCTAGCCCGGAATGTCGCGCACTGAGTCGGCCTCCCAGTTACGTTGGTATCTGGAGAATTATGCGTCCAGTTCTTCGGTCCACACGGC
TGTGGTGCCCGAGTACACCGGGGGACACAACACACAGTGGGAATAGCTGCCAACGTTTTTCAAAATACCGTTTATGTCATTGAGCTTGTCCCCAGACCGA
CAAACGGATGGAGCTGTTTGAAAAATATTCCCACTACCGTCTCCTTCCATAATCGCGTGGCCGAGACGGCGGCGGAATATTAGCTGCTCATTCTCGAGTA
AATGGACGATGTATTCGCTGCTAAAATCACGATGCCTGAACGCCCTCAGCTCATTCTCCAATATAGTGAGCACAATTATTCAGCATTTATTCACTCTAGC
AGTACCGATCGACAGCCAGCTCTTGACGAGGATACGGATCTGCTTGATGCTATCTCTCGGGACAAACCAGTGCTTTGGGTACAACCCACTCTGCGACACG
GCGGGGACATTAGACTGATTGTTACCGGAGGATGCGACGGTCACTGCCCCTACTCCTCCTATGGCCTTACCCAGCCACGACATACCTGGATCTACCGATT
CTGCACTTTAGCCGGAGTTTAACAAGCGCTACAAGTGTTGGAGAACCAGCTCGCCCTTCCTCCACTTTCACTCACGCCTCAGATCACGCCACGTCAAGCC
TCACCTCCGGGTCGCAAACGTGGCCTCATCTCTTCGCCCAAAATCGACCGTTCGCAAGGAACGATGGTGACTTACCAGCGCGTCACTGCGTTTTAAGAAA
AAAAGGCCGAGTCGAATCGGCACCTTCGGACTCCGATACCAATGAAGGTGACTACGGTCGCATCGATCGGGAGGACTGGGCTTCAGCGTGGGAGAAGCTG
GCCACGTAATGGCCAAATACCAGGCACATCCCTTTTCCCACCGCCGACAGCTCCACGACGGAGTGGCAACACGTGACCCGGATAGCTCCTGACCATTTGA
TCTGGCTTTTCAAGCGCTTCATGTTTCCAAGGGAGTTGCTGCAGATTCTAGACGACTCGGTCGTTGAGATGTGGACGGTTGATAGCCGGCGGGCGTGCAT
CGAAGGGTCGTTGCGGCGCTACCGCAATACATTAACCGACCAGCCAACGAAAGCATGGGTTGATCGCTGGCTCCACAATATGCGGACTTCGGATCCCATT
ACGTTCGCATCACTGCTCGAAAGCTATGATGATTGGGAAAACTTGTAGGCTCGAGCCTACGGGGGTGACCACCTGCTTCCACTCTTCTATCCGAAGCGTT
GCTCCAGAATAATTCACCACATGCTCTGTGCCCTACTATACAACCATGAGATAGAAGCCCTAGTAGGGTGCTCCCCATCTGATTTAGAGGTCCCGGATAA
TTTACAGGCTCAGATCAAGCTCATCTGCGACAATAACAGATACAAAAAAGCTTACTACACCTCCAATTGTCTTGGAAATTGGGCGGCGATTGAGCCGCTG
ACTCGTACGTCCACAGGAGAAAGATCAACATTTGTACTAATGAAAACTCACGCAATTTCTTCACGTCACACTACTACCGATCGGAGCTTGACCTCGCGCC
CGTAAGCGAACGCTTACGGGCGTCACATTTTGTTACATGGCTTCGAATCCGAGTCATTCTAAATAGTCCTTCTCGACAATGGGAGCCGTACCGGCGAATT
TTTACGCAAAACGTCCATGGCTTTTCAAAAGTTACACGTCAGGTGTGAATGACAGCGTGGCGCCAGATCTCGCTGCATCGACGTGCTTTGGCGTGTTTCA
TTCAAGAAACGTATATGGTTAGTGTGGACGAAGCAACGGCACTGCAGCTCGAATGGAGGCGGATGTGTGGCAGACATCTCGACGAGGACTAAGTACATAT
GTGTGGAGTGTGGGATCATCGACAGTCCGATGAATTGTTATTCTTCTCTCCCCCTCGGTAGCATCAGCCCGCAATTGGAACTAAGGTTCACGACATCTGT
ATACTCAACATTTACGCACCAAATATTCGGGCTGAGCGCGAGGACATTTTCCAGGGGCTCCGCGTTTAAAACATACCGTCCAGTAGCTTTGTCTTGCTGG
GCGACTTTAATTCCCAGAGCCCGCAACCAGATATTTCAGGCCCACGGACAGCTAGCGGTCCGGTAAGTCTGGCACTGAATTCTCTGTGGGAGAAGGCGGT
CCTAAGTGATGCCCGGCTGTTACGATAGCACGCAGCGGATGACGACGAGTTTGACACGATTCATCACTACCCATACTGGACCGAAGCAACGGCTAGTCAG
CTTGATATATCCTACGTTCTAGATTTCTGGGCTCTGGACGTCCTCTGGGTATCTACGCCCCCCCCCCACAGCCCTGCGATAACGAGTAAGTGGTGCTACA
CTTACGGGGCAAGCGTTTGGATGGCCTATCCACACAGAGGCAGCACATTTTCTATCCTATCCATTCAAACCATCCCGACCGCGCCTTAACGGACATCATT
CAAGAGATTACGAACTCGGGGGTAGGGCAAGCGCCGTCTGTCCGGTCCTGGGACACCCGTATTGCTCGGAGAATATACTGTATAAAAAGGTGATACGAGA
ATGGTAAAAGCAGAGGCGTAAACGCTCAGTTTTAAAGCTCGGCCGACGGAACAGGCGACAGTTTTTAACTCGACAGCAATGGATATCCGCCAATGTGGAA
GAGATGTGAAAGGAAAACCTGGCTCATCTCGGGGAGACTTAAGAGCGGACGAAGGAGAGTCTCCGCTGGTCCTGCAAGCGTATTGCTGATTGAGAACGGA
ATCAGCGCGTAACTTCCCTACAAGCCCGTCACAGACCGGATTTCACGTGCACCATGTCAATCGCAAATTAATTCGCATCTGAATGGGTATCAGTCCTGAG
TCAG