Description :
From Genome Similarity Track
Location :
Scaffold_194:101543- 109122
Transcript NameFunction/comments
Hyaar_Emoy2812348hypothetical protein
Hyaar_Emoy2812349hypothetical protein
Hyaar_Emoy2812350hypothetical protein

Sequence
7579 bases(100 bases per row)
GAGCGAGCGAGCGTTTCGAGCCACAACAGCTCTGCGCGACGAAGAATTAGTTCGTCAAGTGTACCTCTTGACACTTCTGCTGTAGCCGTGTGAGAGCTTC
GTAATTAGCCACAAACTAAGACTATGGGCTAAATGACGACGGTCGTTGCTCGTGTATCGCAAATTCAAAACCGTTTGCCGACTTATTAATGGAACGAGAT
GACAAAGGTGCTGGTTAACGCCAGAAGAAGGTCCAGTTACCACCATGAGCCTGAGGCGCTCGTCTTGTAGTAGTTGCCACACATCATCTCATTTCCCAAT
TCGCGCTCTTGCCCTAGCGTCATATTTAACATCAATTGGCAAACGCTTAAATGTTTGCCAACCACTTTGTAACGATCGCACCACATGCGGCCATCATGGT
CGGCCCCAGAGACTGCAGCAGCAGACGGCTGCAGAGACCTTCGGTACGGCAACAGATAAAGACGTCAAGAGGCGTCACGACGGGTAAGGCAAACGCCATG
CCGTCGAGGGGCAAACAGTCACAGCTATCCCTATTGCCTTCTGTGAATCTGTTACAGCTGAACACAAAAGCGCGCCATCACAGGTCTCCTACAGGGACGT
CTGACTAGAAGTGTCAACTCTACTCTACGGTCAACTATAAGCTTCTGTTACGAAGCAAATAGGGTTTTTGAGGCTCACGCTCTCACGAAGTGATAGCGCT
TATAGTATCGTACAATTTTAGTCAACCGCTGGACTTATTCACCAAAGGAAGTGAATAAAGATACAATTATCATATTTTTATCACGTAAATTGTAGTTGTG
TCACAGATGGACATGGTAGTAATTATTGTAGCAAAGTCCTCCAATTTCACCGATTTTAGTCTAGATATGAAAAATTAAGCAAGGGAAAAGACGACCGGCT
CGTCATATCGTACCGTACGGAAGTTTACCGTCGCAGTCGCAAGAGACAGAAAGCCAGAATGATGGCACTTGATTTAAAATGAATTCAGTAGAAGGGTGTG
CCTGGATACGAAAGTGGTAGCGAGCTAGTAACGCCTCCTCTGTGGACGCATGTACACTACCAAATAAAAAGGAACAGACTGAGGCGCGCAAAGATCGAAG
CCACTGACAAGACTTGAGGCAAGACGGATGAAAATGGCGTGAAGAACGCAATTGACAGTAAAAGCCGAGTTTGAGTGCAACAGTCGGTTTCAGTTGACAA
ACGTGTGCCATTTGATACCATTGTGTCAGTACGCCGTCCATGGTTGTCACGATGTCATTGTAATCGACAGGCTTTCATGTCACATGAAGCTTCGCTTTTG
TGTCATTGATCGTCACTCACTGTAGCAGATTGTCCATATACTTTATTTAAGCAATTGAGCTGAGAATTAAGTGGAACTTTGAAGCTGTCAATGCAGTCAC
CTTCAATTGAAAAGTACAGACACCTGTAGTAAGAGGAATTAGGCCAATGTCAATGGCTGGACACGACTTAGCCTTTCGTTCTACACACACCGGGCAGACA
TCGCTGACGTGATACTTTTTATATCTTAGTATGCGCGAGTGTAATAGTTTACGTGCTCACCAACCGCACAAAACAAAATGCGGACGTCTTCAGTTGCTAG
CCCGTTGACGTCATCCGCATCAATTCTTCACTCATCAACTACATTGACATGCATCGCTCATCTAAAGCTTGCTACATATCAATGACTGACCGGACCTTTG
GCTTGCTTCCGTTAATAAATCGTAGTTTCTCGGTGTTAATGTCATCTTTATCGTCGTCAATGCCGACCAGATCCCTTCCGTCGACAGTGCTATCACCACA
GCACCCAATCACAGCTCGGTCTCAAGATTAGCAGTCACGTGCATATAGTATCTCTTCCTCCCTCTTATTCGACGCAGCTTTAGCTAATGTCATTAATTAC
TACGATCAGCAGCACATCGAAAGTCCCATGAATGAGGACAGCTGAACAAATTTTCGAGACCCTCATGCCCCAACATCCTGAATCCGCCTTCAATTCGTTC
ATGCAGTACATATCGGTGTCGGTTGACAAAAAAAGTAAAAGTTGTACTACCATTCACACGCCGGTGAGACTACTGCAGAGGCAATGCAGTCGAGTGCTGG
AGCTGCTACGCAGAGCTGTGGCGTTGATCTTGTAACGGAAGGTAGGAGATAAAAGCTTCATTGCAACATGTGTCGTCGTGGATAGTCCTGGAGCTCCAGC
AATCACTGCCAGAAACATCCCAAGTTTATAACTAGCGTGCGGATTATGCAGTATACAAGCCGACCTGGATCTTACAGAGCGTCGCGTCGCGCTAACAATT
CTTTGGTAACGTGAATGCTTCTAATGATCCGCTTCCTCTTCACAGCAATAGAAAGCGGGACCACAGCAGCCATATCTCTACAGCAACGTTATTCCGGAAT
GATTTCATACAGCAAAAAGTCCTTTGCTTATTCAGCCATGATGGAGGCCACAAAAAGCTGCAATGAAAGTTCGATCAAGCCCAGGTATTATCGGTGTCGC
TTGAAGCGTCACATTGCGTCCTATTGCAAATCGGGAACTGACCGATGCTTGAAATTACTTGTGGAATTTGTTTAGAATGGATTCTGGCCGGTTGTAGCCG
CACCAAGTAGCAAACTATCGACCCAGTGACAATTCAGTTGTTATGGTCAGCACCGAATCGATCAATGTATCTTCCTGGTAAAGTTGGTAGAGCGTGCCGA
ATTTTTGGTCCAGATGTCAGCAAATGCGAGATACTAACAAAAACTGAATGAGTCTATCCGATACCTGTAATTTGGATTCTTTCGATTACGAATTGAGAGT
GATATACGTGACGACACTCTACTAAGACCAACTTTTGGTCCAATACGAAATACCTTACTTAAGGCGATACTCCCCATGATTGAAACCTCTATAAACTGCT
GCACGCCACATTGGTGACTCGACACGATACAGCTACTTTCTCTGTTTCCGGTCTTAAGCGTATCCTTTTTAACAGGTTCAAATTGACACTAACGTTTCTG
ATGCAAGTGAAAGGGCCATGCAGGGTTTATGCTTTTCCATAGTGGCCTTCTTTCCGTGTGACCAACTTAAACACAAAGTCCGGTTATGACCATGGGGTCA
TGGTTATTAACGTTCGGATACTGGAGCACAACATTCTCCTAAGTTGTAATCAGAAATACAGGTCTATCTCTATTCGTTTCGAACCGGTTACGGGGACACA
TCAATTCATAAATACGCACAGCAACGACAAAAGTAAGCGCTAGCGATACTAAAACTAATTGCTGAAGTGTTAGCGCTGCAGTGTAGCCGCTAATTCCATG
AAGTAATGCTCTAGTTCAGCTTGGGAAAATGCTAAAATAACCAAAATGGAAGTCCAGGTTGCAGACTAAAGTTATAATTTCACTTTTTAGGAGAAATTTT
AAATGTGGTGCACACGAAACCTGTCCTCTCGTTAATTGAACAGGTTCACTTCAACATGAACGAGCTACAATAGCCGACACCTTAAGCCAATAGATCAGTG
GTCATTAGCGTCCACCACTCGCTGCCTCTCTCTATGGAGCTCTGTCACCACTCCGCTCACAGTCTGAATCGTCCGATGTACAGCGTTGACAGATCTGGGA
ACGGTACGACCGCTTGCATCCAAACTTCGACTTTGCGCAGACCAAACTGTTTTCAAAACACGGCGGATTCCGAGCTCTAAGCTCCGAAACCGTTGGCAGC
GGACGCATGACGCCGCCGTCATTTGTTTTAGCCTTTTTTGATACAAGCTCATTGTATGCAGACACGAGCTTCTCCACACGCGCACCATTGGCGTCACGGT
TGCCAGGATTGGCCCAGAACTCAAGTCCTTCCGTCATATCGACGACGCTGCGCGAGTGGCCACCTGCCAGAGACGTCGAGATTGTGGCGCTAAATTCAAT
GCCACCAGCCTCGCAGAACTCGTGGTAGTCGGCGTACTTGTCGCCTGTTTTCGAATTGACCATGGACGTGATACCTACGACGTCATCCAGCAAAATGTAG
CCCAGAATCTTGTACGAAAAGGTGCAAGTCACGCCATCCGGTTCAACACCGTGAGGGCACAAGCCACCTGCAAATTCCTTACGACAGGAATCAGTTTTGT
GATCCCAGAGTTCCAGTGGGCAGCTATTGGGGAAGGAGAACCAGTAGTTGTGCGGATACGGCGCAATGGCCTCGTTGTCCTGCAGTGTGCCTCCCACGCA
AAAGCCAAGCTTTGGCTCACCAGCAGCTCCAATGTACTGGTCACATTCTTTAGGGAATGAACCGTCAGCATTCGGGTTGCATCGACCGCCATCCAGTGGC
ACGAATGGACAGCTCTCGATGGCAAATTTGTGCTCATCAATGGCTTTGGCGTAGTACTTCATGGCAGCGGAAGGCTGCACCACGTTTGTTTGGTAGAAAA
CGACATACTTGATGTCGTTCTTGCGCTTACAGCTGTCCACAACTGACGCGTTGATACATTCGGCTTGCACGTACTTGAGTGCCCCCTCGACGGACGCCAT
GTTGACCGTATCGAGCACGGCTCGGTATTTCTCGTCAAAGGTTTCGTAATAGGCCGACACGAAGCGTTGGTGTTTTGTGTTCCATTCCGGTTTGTCGCCC
TGGACGCGCACTCCCAACCGCGTCACCATTGAGAAAGGAGGTGAAGACGACGCCGTAGGCAACGTCCGGAACGTCCAAGCTGATCCAGTACTCTCCTCCT
GCTCGTCTTTGCTGTCACTGCATCGAAGAACAGGAACATATTTCCCAGCAGTGGAGTTCGAAACCAAGTGGTCATCCTGCGTCACGTCTTCATCTGCGAT
GGTGAAGTTTGACTCGGGTCCTTGAGATTGCGTCACTTCATTGTCGACTGCACCGTACAGTTTACCCGGTAAGTCATAGCTGTCGTTCGCGACCTGGAGC
CGTGTTTCGTCCTCGCACAGGACAATTTTGCTGTCCACAGAAACCCAAGTGACGGCTGTTGCCATGCAAATAGCCAAAACCACAGAGAAAGTCTTCATTG
CACAGTAAACGACTGACGTGGGCGGAAGTGAAAATGGTTCGACTGCAATGCCGTCAATGACCAGAGACCATTGCAAATTTGGTGTGCCCTGTGTGACAGA
TAGGCGCGATTCTGGGCGACCAGGAGCGGAGACCTGACGACTGGAAGGCGTTGCAGAGGATGTGCAGCACTCTCAGACAGGCCATGTCGATCGATCAGGT
TAGCGGATACCTTTCTGGTTTACGCTTCAATAGCGGAGACTTTGCTTGTTACTTGAAAGAGTCGGATGTGTTTATTTGACGAGTAATACGAACAACATTG
TTTTGATGGCCTCGTGATCTGTTTACAGTGAGCGCTTTCAGGCCTCGAAGAGAGTATAGCTGGTGTACTAGCTCGACTGTTAAGGCGTTGGCGATGCTTT
TTCGTTTCCAGTCACGGTATCACCTCATCTCAAGGTGTGCGTACAATAGAAACCTCGTAAAAAAGCGGCGAAAGCGAGCACGATTACGACAGTTTGATGC
ATCTCTATCACGCAAAGTGACTGTCTCGTGCGCTATGACACCCTTACAGCAAGAGAGCACGGTGGGTTGTACGGCCCCGTCCAGCGCCCTCTGTTCCCTC
AATGCACCTCGGCTTTGGTGATTGGTCATACGAGCCTTTTTGGAGTGCATTCGCCCTGTGAAGTCCGACATGTTGAGCCAGCAGAATGAGCTAGGGAAGA
GGAGAGCGATGTAACCATGTCAGAAGGCGAAGGAGCTTTCTTTACAGTCAAGTTTTGAACCGTCAGAAATATCTATAGCCAGTCGGATATCTAATCCTTT
CTCATCTGTGCAACTAACTCGGCGTGACAAAGCGCCATTTAGAGCTTTCTTGACAGTCAACACGAAGGCTTCATCTAATGTGCGCTTCTCGCCGTTCGAG
TCCCTGGATTGGTTTTTGATCTGCTACAAAAATCACGTCATTACTATCAGTCCTGCAAAAATGTCTGGAAATCTGCTGAGGACAGCATTCTTCTGGATCT
TGCTACAATAAATTTTGGAGCCTAGACGCATGGTACGAAGGTATATGGTACATTCGAAAGTTGGATAGAGATGAGGAACGTTTAGCATCCAGTGCTGCTT
CTTCAGCGTAAAGTAGAATCTGTCGAAGCTGATGCCATTAGCACCAAAACATATTATTTCCAGCCAACATAGGGTTATCAGTTGAATTCGTTCCTGATCA
CCAGTATGGGATGGCCGAGACCTGTTAATTCAGCTGTTTAGAAAGGGCTACAGCTAAAGCAGTGTCGCTTCAGGCAAGTTCTACAGTATACGACAGACCA
TTGCATCAAGAGGTGAAAGCCCCGCTAAATATTCACCTTTCATAGCTTTGCAAGCGCAAAGCGCACTGCTTTAATGCTCTCCATATATTAAAGAAAAACG
GGGTATCATCCCGGTTACAACACCTCCTTTCACTTATGGGAGACCGGTAGAAGAGCGCTGTGCTTTTGTATTTATGTTGTGTTAGGCGCGTGTATTTTAG
CTAGCGATCATAGTATCCAGCGGCTTATCGCAATAGGCTTGAGCAATTGGTATTCGTGCAATATTCAACAGCTGCAGCACTGATTGTCCATAACACTGTA
GTGTAGTCCCAGCTTGCGAATGTCGATCGATTTTGCTTGCTATCGGGCGAGTCCGCACAGTGCAATAGTACCATCACGCATGAAAGGGATGTGGAATGTT
TATTAGTACAGATACGAGGTGGCTGGGTTTAGCTATTAGACATCTTATGGGACACTTAATAGCTTCCGGCCATCACGCAACCCAAGTCGGACGATGTACA
AACCTCGCAGATCTGTGAGCGATAGGTGCGCTTACACCCAAACTTGGCCTCCGCACAGATCTTGCTGTTTTGGTAGCACGGAGGGTTACTAGTCATCAGT
TCGTCCACTGTGGGAAGTGGTCGCATTACCCCTCCATCACTTGCTACAGGGTTCTTCTCGAGCAGATCAGCGTAAGCACCCACGACCTTTTCCGACCGCT
TGACATTCGCGTTGCTATCCCCAGGACTGTCCCAAAACTCGATCCCATCTAGCCATGTGACGTTATCTCCAGACACCGAGACGCTAAATTCCACACCATC
GGCCTCACAGAAGTCGTGGTAGTCAGTGTACGTGTCGCCTGTGTTTGGGTTGACCATGGACGTGATACCCACAACGTCATCTAGTAAAATGTAGCCCAGA
ATCTCGTACGAAAAGGTGCAAGTCTCGCCATCCGGTTCAATGCCATGAGGGCACAAGCCACCTGCGAATTCCTTACGACAGGAATCAGTCTTATTGCTCC
AGCGACTTAGCGGGCAACTGTTGGGGAAGGAGAACCAGTAGTTGTGCGGATACGGCGCAATGGCCTCGTTGTCCTGCAGTGTGCCTCCCACGCAAAAGCC
AAGTTTTGGCTCACCAGCAGCTCCAATGTACTGGTCACATTCTTTAGGGAATGAGCCGTCGGCGCTCGGATTGCATCGTCCGCCGTCCATAGGAACAAAG
GGACAGTGTTCGATAGCGAAATTGTACTCGTTCGTGGCATTGGCATAGTAGTTCATTGATGCAGGAGGCTGGACCACTG