Description :
From Genome Similarity Track
Location :
Scaffold_304:10154- 19367
Sequence
9213 bases(100 bases per row)
ACCACAACTAACTGTTGGTCGTATGAAGAATTCCCACGCGACCACACCCCACCTATTCCCAACTCGGTCAGGCCATACATCGACCTCAAGCCACCTAGAA
GAGTGCAACCCGCCCGCCTACGGGTACACAAGGTGAGAAAGAACAAGACAAGACACACGGTCCGGAGTCCCCCCTCCGTTAGTCGGTCGTCCAGGCGCAA
GTAAAGAGTTGGGATCGCTTCGCAAAATGAGCAAATCCCACTCGACCACAATGGTGCGCGTTCCCGGATTCGTACCAGAGATATCACCGTGAATCACAGA
GCGAAGATGTCAAGGTCAAGGTTGAACGGGGGATGGAAGTGTCGGCGAAGAAGGGATCATCACAGACACGTGATCATCAAAAATTCTCGGTTCGTCAAAG
TTTTGGGAGGGGCTCGGGTGAACCGAAAATTAAAGAGGAAGATCACTCAAGTGATCTTGAACAGAAACCAATATTCCCTCCTGAGGTTCCTTCGGGGACC
ACCGCGGGTCGTACTGCAGAGTACGACCTGCTAGATGGAACACGTCCAGCCAAAGCAGGACATGTTTCGTCTAAAAACAAAACTACATACAAAGACAAAA
GATCGAAGGCTACGGCTCAAAAGCTACGAGCACCTGACTCCGAGGGTGACGATCAGGAAACGAGCGGGGCAGCAGAGGTCAAGATGGAAGGTAGGAAGAT
GGATCAGCTACAACGTTGTTTGCACTGGACCCAGCTTCAAATTTTTCGATCAACAGATCCAGTACTCACGAACTTGGAACCGGAGCTGATCGGACCAATC
CGAGGACATACAATGGCACCAAGAGCTTCCACAAGTAAAATGGAAGCGGTACAACTTCTCATTTAAAATGCTACGAGGCGCAGGATTCGTACCGACGGCG
TTCGATGCGCAGGTTTTGCTTGACTGCGACCTGGATTAGGTGATCACGGCCAGCCGATCACTGTTTACAGCGCTGGTCCCACTGACCGGTAATTATGACT
CCGTTGATCGCGAACTCATGACCACCGCCAAAGTCAAAGAGGAAGAACATTCCCCGGCTGTGTCGTCAAATGACGCCTCTGCGGAGTCGGATGCAGAGGA
AAGCGATGACATGGAAATCAAACGAATGTCGTTGGGACCTTCCGGAGGAGCACTTTTGCGTGACCACCACGAGCATACGGCACCAACCACCAGGGCGATG
GGTTCAACCACTAAGCAAGTCCCTGCTATGGATAAGTCCGACCAGATGCAAATCTACGTTGCAAAATTCATGGAAAAGTTCTTACAGGACCAACACCTTC
GACCGCCTCGTACCGTGCCTACCGGTCGCCCCACCTCCAACCACAATGTGTTCGGGGCGTGTATGCCGGACACCGACATGGGACCAGCTGACTCGTATGA
AAGCCGCAGCAACGTATTCGACCCTGAAAATCTCGATATTGACAGCCTCCGACAACCCCACTTGGCTACCACAGAGACCATAACAGGAAAAGGCTTTGCT
GCGCAGCGGATTCGCATGTCTGCTATTGCCGAGTTAAATGAATTTTCAGGCCGCGATCACGACGATGATCGTACCTGAGGATGGGTACGCAAAGTCAGGT
CAACTTTCTTGCGTGACCAAACCCCCGACTCGGAGAAGTGTCTGGTTTTTGGTGATCTACCAACGGGCCCAGCACGAAACTGGTATTCCCAATTGAGTCG
GTAGACACGTAATAAGTGGGAAGATCTACTCAAGAGCTTCCTCTTACAATACGGCTGACCCAGCGTCTCACCTGGTCGCCAGTATTATCATGCCTGCAAG
CGTGCCGATGAGACTCCGTTAGAATATCTTTACCGATTGAACGTTGCTGGGATGCGAGCGAAGATTCACGTGGAAGATGGGAATATCGCTCATCGCTGTG
ACCATGTGGAACACATATCGAAACACTGGACGATCGAGACCTCGCGAAACAATTAACGCTGCTGCGATTAGATGACGTATATACACTAGAAGCAACGCTA
CACACATACGAACGTATGCAGAAACCTAAAGGCAACCTTCCGACCAGTTCAAGCAAGTTCCGCTCACGATCAGCCTCACCATACATCCAAAGTCCATCTA
AACCGGCTCGAGCCGTGTGTTCAATCCACGTGGGGGAAAGAGCAGCTCTTCAGAATCAGATATAATCGGTTCAGACTCAGACAAAGAACAACGACGTGTT
TACAGCGCCACGGCAGCCGACCAAACCCGATGGATCGAGTAAATGAACGTCCGACCAAGCCAAAACTGGGTGACCGGGAGCGAGATCAGGATCGTGAAGG
AGGACACAAGTCGTGCACTCAATGTGGGTCGACATGACACGATGATCGTGGATGCTAAAAACGATTTACCTGTCATAAGTGCGGACGCCGAGGTCACCCC
TCTATCAAGTGTTTCTAAGGATGCGCAGCGTGTGGAGAGGTACACGTCGGGAGAAAATCCACGATGGAAAGGTTTACAAAATGCTCCGCAAGTGGTACGT
GCCGTCCAAAAATGCCGGAATGCATCCTCCTGACGCTGAGAAGATGTTAACTAGGACGCTCGCCAGGTTGGAACCTGGTACGAGCCGAGCGTTCTCGTCT
ATGCATATATGCATTCATTGAGAGAGAAGGCGTTTATATCAGTGTTAATCGCCTGACCGGCCGAACTTTTAGTACATGTGATTTGGATTCTACTTGTTTT
TCTTCAATTGCAAGTCTGCGGCGACCGGACGAATACGCACGATCACTCACCAAGATGGAGCTCAAGCTGTCTCCTGGCAAATCACGTGGTTACTGGAAGT
ATCATACTCCAAACAAGTGGTTCAGGCAAGCCAAGGCAGGGGGAAAATCAACAATGAGAAGGCCACCCTACTGTTTGACTCGGGATCTGAAGTCACAATC
ATCGACACCACCTTTGCTCGTAAGGCTGGCTTTGTCATAGAAGAGAGTCAGAAGCAAAAATGTGTGGGTATTGGAGAGAATTTATACATGACCGAAGGCC
GCACGAAGATAAGATCACGCTGAATGGGTCACTAGTCTACTACTTTGATGTATGGGTCGGTGACCAAGTGGGACAAGAAGCAATTCTAGAAATGGATTTC
ATGGTACCGGCTGGAATACGCCTTGAACTGGCGGACGGAACAGTTTGTTTGCTAGAAGAAGTCAGATTTCATCTGGAAGGTAGAAGACCACCGTATGGGG
CGAAGATACAACGAATCGCTGCGGACGAAAAGTACTTGGCGATCTCGGTGGGTAACTCCGTGGAAGCCAACGTTGATCGAGGACCACTGCAGTCGAAATT
GTGGCTAACACACCACTCACGCTGGGTACCTACAGCTACGACTGGACCCGGAAGGCTAACGTACCTTCTCTTGGCCAATCTGACTGATCAAGAGGTGATC
ATCCAACAAGGGACGCCATTCGGGCAATGGATGCCGGTGGATATGATACCGCGATCACCCGGGTATGTGTCCGTGGGGTCACGGCGATATGAGGAGTGGC
AGACACTCGCGTTTGAAGCTACTACGGACGAAGAAGAAAAATTATTACCGTAAGTAGATGGACTGATGGTCGTACACCCGTCATATCCAACGCCAACGCG
CACTCTAAACCGACCGCCGAAGGATATCGCAGAGACGGTCGTGGGAGAAGAGGAAGCAAAGTTTGAAGACGATATGCCGATATGTGATCCCGTGGAAGAC
CAAGATAAACTTAAAGGACCACAACCAGGACAATCGCCAGTGGTTATTAACGCGATCAACATACCTGGTAGGACTAGTGACGAGGATGACGGCGATGTGG
TTTGTGATTCGGTGTCGGATCAGCTGGAGCTAAAGAGTAAACCCCAGAGAGACATATCGACGCTATTACCAGCGACAGCCGACATAGACACCCCCGTTGA
CGTGATGGAAGACATTACGGTGGTGCGGGACCAGTCCTAAACGCAGCCAAACGAGTGCAAGGGGAATCTCACTTCCGAACCGATCAAGGATATGGTATCT
GATCGTATGCAAGACCAGTCCACCAATCACCTAGACGGGACTACTGTTAAGGATGGTGAGGTGCATCGACCGTCCGACCATCAGGTGAACCAGAAAGCAG
CGATCACAAGCGAAGGAGCACGCAAATGCTCGTCATACCAACGCGAAGGTGGAGTATTTTTCGCGAAAGACGTTGGCCAACACATGGCAGTCTTGCCAGA
AGTAGACGTGATGCTGAGCGAGGTAAAAATTGACGCCATACAGGTGGGCGATCCAGGGGTCCCATTGACCAAAGAGCAAGAGGAATTTTGTCAGCTGATC
TGGAAGAATCGACACCTTCTGATGGGCGAAGGAAATGCCCTCCCACCTGCTGCTCGAGGTGTAATCTGCGATATAGATGTTGGAGGAGCGACCCCAATCG
CACAACGAGTAAGGCCAGTCACCCCAAAGTTCCGTGAAAAGTTGGCGGACCTAATCAAAGGGTTACTATCGGCAAGAATCATATTTTCCTCAACTTCGCC
ATGGGTGTCGCCGATCGTAGTGATCGTGAGACGAATGGGGTGAATATACGACTGTTTATAGACTACCGAAGAGTTAACCAATTGAAGAGGCTGATGGTAT
ATCCCATGCCCCTGATTAACGACTTGTTGCAGGATCTGGAAAAAGAGCTATGGTACTGTTCATTGGATATGGCCAGCGGATTCTGCTTTATGGAGCTGAA
GAAAAGAGCACGAATGATCTCTGCTTTTATCACGCCCTCGGGTCTGTATGAATGGTGACGCATGCCGTTCGGTCTGAAGAACGCGCCGCAGATAGATCAA
CGTATGGTGGATAATGCGTTATATGGATATCTTATGATCGGGGATCGGCCGAAGCCAAGTGACCACGAGGCTTCTCAACAGGCCGATGTGTTTACGGATG
GCGAACTAAACCCGCACCGGAACCCTTCGGTTCTAGGAAGAAGGTCCTACGTTGATGACATTCTAATCCCAGTGTCATCCTGTACATCTCTCTATAGAAA
GGTGGAAAGATTGTTGGAAGTGTGTGATCAGTGGAATTTGTCGATCAACCTACCTAAGAGCGTCTGGGGATGAAACAAGGTTGAGTATCTCGGGCACCGA
GTGCCAATAAAAGGAATCTAAGCTGACCCGAAGGATCTGGGGTCGTTGGTGAATATTCCTTTCCCCAGACACTGCGGTCAATGCAGCTCTTCCTAGGAAG
CTTGAATTATTACAGCTGGATCATCGAATACTTCACCATATACGCTTGGGTCTTGTACGAATTGAGGGAAGCTGATTTTCATGATATCAGGCGTTCGCAC
AGCACGGAAGTTGAAGGCTCAACCATCTATGATCACGGCCATAATACCCATATTGATGATGACAGCGGGCAGCGACCAGCAGGTGATCACGATCATCCAC
TGGTGACAACGAATGGTCAGGTTCCAATTAAAGTTAAAGCGTCCAATAGAGAACATACTGGTGCTCATCGTTGGGAGAAATCCATGATTCCGTTCACCAT
GTTGAAGGCTAAAGTAGCCCAAACCCCGGTACTCAAACATTTCGATCCAGACCGCCGACCAGTGATCGTGGTTTACGCTTCCAAATGGGCGGTACCCGCA
GCTTTGCTACAGGAACATGATGGATTGAATTGGCCTGTTATGTTCACAAGTCGATCGCTACATCCAAATGAAGTTTATAATGGAGCGGTAGAGAAGGAAG
TTCTGGCCCTGCTCCAGATGTTGGATATTTGTTATACGCTATCGGACTCTCGGGATTTTGAGGTTCTCACAAGATATTCTACCTTGGCATGGTTAATGCA
TTCATCAGGTCTCAATCGAAGACTTGGCAGATGGGCAGCTTTACTGTCGACTTGGACTTTGGAGATTAGTCGATGTAACAAAGGGGAGGACGAAATCCTC
GGCAACCTCGCAGCGTGTATTACACCGCGGAAAGATATGGATGAAATGTTGATCACGATCGAACCACGGAAGCAACCGAGACAGACTATCAGCACGCCTA
TCCCTACGATCAGACGTGGCGAAGTGCTTCTGGTCGTCAGCTTTGACGGATCATCACGTATCAAGGAAAAGGGGGGCGCCTACAGTGCAGTGAAATGGAA
ATTGCCTGAGTGGACCATTTTGTCGGCTGCGTCGCGCTTCGACACTGGATTAACAGTAAACGAGGCAGAGTATCACGGGTTTCTGCTGAATTGCGACCTG
CTAGTGAAACAGACAAGGGGACGAGTGGTCATTTGTGGGGATTCCAACCTGTTCATCAGGCAGATGCAGGATGAAATTGATTGCAAAGCACAGGACCACA
ATTACTGCGTCTCAAAGCCCTAGATCGACTTAGGTCGTGGCCGACACATAAGTTCTGACACGTCAAGAGCGATTGGAATCAAAGTGAGGATCGACCGGCT
AGTACCGCTTAACAGTTGGAAAAGAGAATGGTTATGCTAACTGATCAGGACCACCATGATCTGAGAGTTATCGACCGACTGGACGAAACATTGATGCCAG
CGGGCAATGATCAAGTGATCACGACGGCGGTGATTACGCAATCGACCATGCGAAGGCGTGAGTTACTCATCATTATGCAAGAAGAGATAATACAGCAGAT
GCGACTCGACCGTATAAAACAGGCTTAAGACGAAGAAAGTTGGATCGCCAACCTCAAACTTTACCTAGTCGGAGATGTTACGGAACTGGGTGCTACAGAA
GCTAAAGCAAGTGCTGTGATTGCCCCAGAATACGTGGTAGATGAAGGCGGATTGTTTTATCTCTGCCCACGATCGGCGACAAACCCCGCCGTGCTGAGCT
CGTTCGTTTGGTAATCCCGGAGTTGCTTCAAGATGATATTCTACACCACTACCACGCAACTCTATAATGTGGTCACCAAGAGGAAGGCCGCACGTATCAT
CTTGTGCGATCACACTTCCATTGAAGAAGTTTGTTCAGAAGCGTGCAATAGTATGTGGGGAAGTGTGTCGACTGCGAAACCGGAAAGGGATGTCCAGCGC
TACGAGGAAAATCCTCGGGGAACATGCAAGCTAAGTACCCGTTCCAGATGATCGCAATAGATCATAATCCTTCTCTGCCTTGGTCATTCAAAGGAAACAC
TTGATTTCTTCTTTGGGTTGATTTGTTCTCCGGCTACGTGATCGCTAAAGCTAGCTTGTCGAGGACGGCCCAAACGATCGCGGAAGGATATGTAGAATGC
GTCTTCAGGCGATTTAGAGCGAGCGAATCTATTCTTCATGATCGCGAACCTGGGTTTAGGTCGGGTTTTTTTGCGCATTCAACCGTATTGCCGGTCAAAA
GCAGCGTGCTACAATGGCATATCGGCCTCAGGCAAATGGCACCGCCGATCGGATGGTCCAAACGTTGACCAGGGCGCCAAAGATGTATGTCACGGACGTA
AACGAACAAGGCTTGGATGAATACGCCGAGCGATTGACCTTTGCCATCAATACGGCGCATGACCGAGTTCGGGTTGATTCTCCGTTCTATCTCATCTACG
GATGGGACCCGCGATCAACTTTGGAAGCAACCCTTGCGTTGGGATGCACCAAAACACGTGATCCTGCCCCTAGGAAATGGCGCTATCACATACAGAGACA
GTTACAACGTGCCCGGGCCACCGTGAATGACCGGCTGAAGGAAGCTATTTAGGACCGGGCTGGCCAACACAACAATGATCTAGGGCCACATGGAATAAGC
TGTGGTAGCCAAGTGTTGCTTTATTTGGATTGAGTGAAAGAAGGATATGCCAGGAAGCTGGCTCACATGTGGCATGGCTCATTCCGGGTGACCGAAAAGT
GTGGAGAACATGCAGTACGGCTGGAAGTGCAGGGGACCCCATACCGATTGTTCCCGCACGTGCACATCTCTAAGTTCAAATTAATACGAAGTCTTCCTGA
ACAACCTGTTGCACGACTGGAGGTGGAAGAAACCGAGCGAGTGAATTTTGATGAAGCTCTACTGCCGGACGGTAGTTGGAAAGGCAATTTAGCCGAAGGG
GAATACTAGGTGGACAGCATTAGAGATGTGAGGTCGGTGCGAAAAACTCGGTACGGAAGAATACACCGACAGTTCCTGGTCCAGTGAAAGGGTCGTGATG
ATGAAACTTGGGTGGATGAAGCAAATCTCAATTGTCGTGCGTTGTTGCAGGAATTTAAACGTGGTCGAGCTAGACGGAATCGGTTTGAAGTGATGCAAGT
ACACACAAAGAAGAATCCCGATGTTAGGGTGACCAGAAGTGCTTACCTCGACACGACGAATGGTGATCGTCTGGTTTGCGAGCGGAAAGCAACAATAACC
ACGCGAGCCGGCAAAGAGGAGGATTTACATGGCTAACGAACGTAACGATTATGGAACGAAAAACAAAGGTGAATTGAGTAGTTACGACATGCGGTCACGA
CTGCAGCCACAAACACAATGGTCCTTTATACCAGAAACGGCCAATCACTTCTCTACGAACTTGTTCTTAAGGCGGTCGGTGGACGATCCCGGGTGATCAG
CGATGGTTGTTCGGTATTGGCTACGCCAGGAATCTGGATAGGTCCGTCAGGCACAAGGCGGAGTCCAAATAAAGGATGTTGGATTGTCGGCAGTCAAAAC
CTGGATACAACAGGCATTTCTCCAAGCGTCCGGAAAAGTGCAGGAAGAAGGGGTCTAACAGGATTTCATGGTCGCACTGACACTCGACCAACTCCTGCAG
CACGATCCGTAGCACAGCATTCCACCGGGGACTAGATCGGGAACGTCGATGACGCCTCTCTTCATAGTAGACGCTCAAACCAGGATCCTTCACGCGGCTT
GAACCGACGATGATTAGTAGCACATGGGTGGACTCCCATACCGCCTACCTGGCGGTGATGGTCTTTGAAATCACGATAGGCAGTCACCAAGTCTTGAAAC
CTACCAGTTGGACGAAAAGACACAAGCGCGATCGGCCTATCCAGGATATCCCATGGTCTTTGACTATATAACGTGGCGATTTGCGCCAAGGTCACCAGTC
GTGGCACCATTGGGACTCGATGGGTGGACGAGCGCGGGGTTCCGGAATGGGAAACGAGTATTGCTTGAGCCGAGAGAAGTGGCGGAACAAGAGGTCCAAA
TCCAGTTCACCCACAGTGAACAAACCCAAGCGGCAAGACGACCACGGCTAAAACTGGCCGGGGGCATAAGTCGCATGAGAGCGATAACCATGTATCCACT
TATTACGCGAAGA