Description :
From Genome Similarity Track
Location :
Scaffold_331:10154- 12416
Sequence
2262 bases(100 bases per row)
CGGAACGCGAGGGTGGGTGAGACCGTTTACGTAGAACAGAGTATAGCCTGTAGAGGCATGAACAGTGTTGTTCAACGCAAACTCAACAACAGGGAACATG
GTGCTCCAACGCTTGGGCGTAGCAGCGCAAACACTGCGCAAAATGTCATTAATGACGCGATTAACACGCTCAGTTTGACCATCGGTCTGCGGATGATCCG
CTGTGGACATGTCCAACCGGGTGCCGAGCACCTTGAAGATGGATTTCCAAAACTTCCCTGTGAAGCGGAGATCTCTATCAGAGACAATTGCTACTGATAA
GCCATATTGTCGAAACACACAGTCGATAAACGGCTTCGCTGTACTTTCTGCATCAATAGAGTCCGGCACTGCCGCTAGATGGGCCATCTTGCTCAATTAG
TCAACAAAGACTACAATGCCAGTGTTGCCTTCCGAATCTTACGGTAGGCCAAACAAAAAGTCCATACTCATGGACTCCCAACACCTAGTAGGTACAGACA
GACTAGCCAGCGGCGCCGCCGCATGTGCTGAGGGATTAACCCGTTGACACTTTTCACACGTACGCACATAGTTGCTCACCCACTTGTATAGTTTGGGCCA
CCAATAAGCCTGGCTCACTCAGCTATAGGTCTTCTCACGACCGATATGACCACTTAAAGCGGTATCATGTGCCTCATAGAGGATTCGATACTTCAACTCG
TCATCATGAGGGACAGCGATACGAGGGTTATCCTCAATATCTGTGCGATAGCACAACAGGCCATTATCGATAGAATATCGATGTAGCCTCGCACGTAAAC
GTGCCGACAATTCTATGTCCGAGTCATTAAACTCCTCGCTCCCAAGAGCACGTAGCAAAGCTACACATTGTTCATCCTTGGCATAAGCCGCACGGATTAA
GTCAGTGACTGACGATGACAGCGTGGTGACGTGAGCAAGCTCATAGTCAGGTCGGCGCGATAGCGTATCAGCCAAAGCATGTTCCTTTCCTGGCTAATAC
TTTACTTCAAAGTTATATTCGGCAAAGAATGAAAGCCAACGAGCCATTCTCTGAGAGAGATGCGGCGACTGTGTCGCAGTGCGCAATGATGCATGATCTG
TATAGATCACAAATGGCTTTGAGCCAAGCAGATGTACTCTGAATTTGGCTAGAGCGTACTTCATAGCAAGTAGCTTTTTGTCATGAACTGGATAGTTCTT
TTCAGCAGCTTTGAGCTGTCGAGATTCGAATGCAATGACGCGTTCGCGCCCATCGACATCTGTTTGTAACAGAGCACTGCCTATGGCAAAGTCAGATGCG
TCACAGACGACGCTGAAAGGACGATCAGGATCGGGCAAAGCCAGTATTGGCGCATGAAGGAGGCTTTCCTTAACTGCTTGAAAAGGTTCATGCTCAGTGT
TACCCCAACACCAATCCACATCCTTCTTAAGGAGGTTGGATGATGGCCAAGCCATATCTGCGTAATTCTCACTATACTCATGCAAGTAATTGGCAAGGCC
AAGCCACTTACGTAGATCTTTTTAGTACTTTGGAACCAGCCAATCGACTATGGCCCTTATCTTAGCGGGGTCCGCTCGAAGGCCTCACTTCCCAATGAAG
CACCCTAAAAAGGGAATCTCGTCTGCACCAAAGATGCACTTGGATGCATTTGCATACAATTTATTCGTGCGTATACACTCGAGCACCGCTCGTAAATGAT
CAATGTGATTATCCACATCAGATCGACCGTCGTTGCACGACTATGGACAAAGATGTCATCAAGTAAGTTTGTGCATAGCCTCGATGAGGTCTGAATAGTC
GCGTCACCAGACGATTAAAAGTAGCCGGGGCATTTGACAGCCCTTGTGGCATAACGGGCCACTCCCAGAGCATACCGCTCGGGGTATTAATCGCTGTTAG
CGAAATATCGCTTGCTCGCATGAGCAGCTGGTAATAACCATCGACTAATTCGAGCGCACTGTACAATGTACATCCCACCATACTGTTCTGAAGAACATCC
TATCTGAGGATTGGCGTCTGAGCCGGGATAGTGGCAGCATTAAGCTTATTATATGCGTGCACAATACGCCACTTACCACTAGGCTTTTTGAAACAAAAAG
TAGGTGTGGAATGGGGAGACTTACTCTCCCTCACCATTCCCGCCCCGTGCTTAGCACGAAAGAAATCGTCAATGACGTCACACTGTTCCTTATGTAAAGG
CCACTGCCGTGTTATGCAGTATTTAGTTCTTGGAACTAGGTCAATTTCATGACGTACACTCT