Description :
From Genome Similarity Track
Location :
scaffold_554:10154- 11595
Transcript NameFunction/comments
g9194.t1 hypothetical protein PITG_20284

Sequence
1441 bases(100 bases per row)
GAATCATTGCGTTGCCTCTGAAATGACTCAGTCCTTGAGCGCGATCGCGATCTACGCTCACGCAAACGTTTGTTTCCACTTACGGATGGTCCATATCGAT
CTTCCCCCCTTGGCCATGGTGCTAAAGGTGGCGGCGCGCCACGGTCGTTTCTGGAGTTCCAATCACTGTGTGAAGCCGATGAGCGGTCTCGTCGCCACGA
AGGGGTGTTGCGCGCGCTACCATGTTGCGAAGAAAGAGGCGATGGCTCTAAAGCGCTTCGCTCGCTAGAGCAAGAGCGACGCGGAGTATGTTCCGGCCTC
GATCCTGTGGAATAGCCTGTTTTAATCTTCGCACCAGCTTTCAACTCAAAGCGAATCTGCAGGAGCTGCCCATCATCGTCACGAAAGACTAGAGATGCTC
GCTCAGCGTCCTCACGGTTGTAGTAGTGCAGGTACACGGTTGCTGGCTGGTTCCTCATGAGCCTCTGCCAGTTTTCTCGAGGGATATCGCACCGTGGCAC
CGACCTCTTGAACGTGTATCGCTTGCTCAATGCAGCTGCGAACTCCTCGCGATCACGGTCCTGATTGAAGCGGATCCCAGTAGACTTGCGCTCAAATCGC
GCATTTCGAGCAATCAACGTGATCCGCCCGCGCACATTCTGCGGTACAAACGCCGTGCCGTACAATTTGCGCTGATAAAATTCTCGGTCCTCTGGTCGTT
CAAAGCACAGCTCTTCGTAGCAGTTAATCTTCCGAGCCTCAGGCTCATTAGCACCACATTCATCAGCAACTGAATTCGAAGGATCTCCTTTCGCTCTTGG
GGCCAAGCACGATACACCAAAAAATGAAGCCGTGAATGATTCCCGGTCCGAGGCCATTTCACGTTTCGTTGCGCACGTTAAGCGAGGGATGAGATCCGAC
AGCGTTTTCCCTTCGACGTCATAAACTTCATATCCCATCATCCGCGCCGTAGATCCCTTCTTGCTGCCCATAGTGTCGGTAGAATGAGCTGCCAGTTCGG
CCGCCGCCATGAAGATGGAATTCCGCTTCCTGGACAAGCGCATTAAAGCCCGATCTTGCGGTGAAAATGGTGCGTTCTTCAGTGGCACCGGATTTTTTGT
TCGCTTGCGCTGAGGAGGAATGGATTCCGCCGTTGGGCTTGATTGGGGAGATGGCTGTGGAGGCACTCTGACGGGCACAGGTGCACCCAAAGTACGCTTA
GAAGGACTTGATCGGGGTACAGCGCTGCCTGCTTGTTCCGTCGCTCTGGATCCAGCGTCAGTCTTCGCAAATGTCCGCTTTGGGATCACAAACGATGGAA
CGCCTGGTGGAGGTGCCGATGACCCTCCTTCCTTTGTCTTTCTTGGAATGGGCGTGTTGTCTAGCAGCAATTCCGCTTCAGTAGTTTTTTTGTCATCTTC
GGGTTCTGGACTGGGGATTTTAATCTGTCCTTCTTCTTCTT