Description :
From Genome Similarity Track
Location :
Scaffold_17:101516- 103531
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_05507Hypothetical protein

Sequence
2015 bases(100 bases per row)
GGTACATAGACCATGTCGACGTTGCCAAACGGCCCGAGGGATGTTTCCAAGCTCACGAGGCCTGCGTTCAATGGCGGCACAAGCGTGAGGTTCTGGAACA
GCACCGCAATTGGCGTCGTGTTGGCGTAGGCGAAGCGAGGACTCTGGCGCACGAGGCTGGCGCTCCCAAGAAGCGTCGCGTTAGTGGCGATGGCCCAGAG
ATCGCTGGCCAAGCTCCAGTACATGCGCATTGAGTTTTGCTGCGTGAGGTGGTAGGCGCCTGGCGTGCTGCTCAGTGGTAGCGAGTACTGCAGCCCCAGC
GCATTCTCAATGTAGAACGCGTCTGAGAAGCCCGTCGTCTTGAAGTTTTGCCACTGCAGAGAGAAGCCCGAGACGCCCGCTTGGCGCCAGTACACTGCTT
CGTCGACGCAGCTCCGCGCATTGCTTTGAATCTCGCTGAGCCACTGCCGGCCATCGATCGACGTGGCCAGCGCACTCGCAATGCCCATCTCGAACGGCGT
GCCCCAGCATCTCGTCCAGTCGGCGTAGCTCGGGACGTTGCCGAGGCTCGTCTCAAAGTAGACGGCGCCATTCGACACGTACGACTGCGTTCCGCACCGC
GCTTCCCGCGCCGCCGAACTCGCGAGTGACCAGCGCCGACGGAGGTCGACAAAGCAGTATTGCGTAAACATCCACGGCAAACGACATGCGTCCATGCGTC
GGAGGTTGGCGACAACGTCTTCCAAAGCCACGTCCGGCGAGAAGAGCTGCCGCCTGGCGGCGTGGCCCGTGACGCTAATCGCGCCAACGCTGAGGTTGTA
GAGCCGCGAGACGTCGGCCAACGCTGGGTCATCGAGCGCAAACCCCGTATCCAGCGTCTGCGTCAAGAGCCGTCGGTTGAAGAGATTGCCCAGAAAGGTG
TACGTGCCCGTAGCGTTGAAGCCAGACCAACTATAGTCGTTGGCGAGATTCGACTGCGCGACGCCCAAGTACGCTACGTTGCTAAAGAGCGAGAGGAGAA
GACTTGGCACGCCCATGCAGCGCCGGATTTTCTGATACGTGCGGGCAAACCAGGACTGCGAGCGCGCCGGCGGCGTCTGCGGCATCGGCGGTGTAGATGG
CTGTACATGCGGCAGGACGAGCGTCGTCGTCGTTGCTTGCCGGTGCAGCCCCGGCGTCTCAAAGCCAAAGGACGCGGCGGGCACGAGGAGCCAAGATTTT
GTGTCGAAAAGATACATGTGGCCTCGAAACCTGAAATGGAAGAGCCCGCAGCACGCCGACGTGAGGGCGTCCAGCGCGATGTACGCGTGGTTGGGCTGGC
GCTCGTGGAGAAATGCCACGGCGGCCACGGGCAGAATGAGCGACGGTATGGCGCGCGCACCGGGACTGGGCATGCCCAGGGGCACGACGGGAAGTTTTGT
GGATCGCGAGCACAGCGCGAGAAGCGCACCAATCGCGACCACGCCGATCGTCAAGAGGACGAGCAGCAGAGTTCGCTGAAAGGTGCCAATGTCGACCGTG
CCGCTGTTGCAGTAGACCATTTCATCCACGTTGACGGCAAAGCACTCGCGGGCCAAGCTCGAGCGAAACGGAAGGGGGCGAGCTGCGTGTAGCCGACCAG
GAGAATCCATGCTACGAGTGATGTACGGGACGCGTACTGATGTGTCTTCTTTTGTAGCACCGGGTGCAAAATGTCGTGGGCCAAATACGTGAGCCAGAGC
ACTTCGCCCGCGAGAAGGCTCGTCGTAAGGAGCGGCTTGGTGTCGGCGCGCAGCGTCCTCTGCAAATGGCTCTGAACGACGAAGACGTCGGTCGTCGCCA
ATGCAATCGTCGCGGCGATGCTGCGGCCCGCGAGGATGCTCCGGCTCAGCCAGACAGGCCCCAAGAGCCGATTCAAATAAAACCACTCGGCATGCTGCGC
GCGATGGTAGAGACCAAGTACGAGAAGCACGGCGGCGACAACGAGGACACCGACGGTCGTGATGGCAGCACAGCGATAGAGGTAGGCGCTCAAGTCGGTG
GAGATCACTGTCGGC