Description :
From Genome Similarity Track
Location :
Scaffold_172:10151- 11156
Transcript NameFunction/comments
g6217.t1RAW35299.1 hypothetical protein PC110_g8383 [Phytophthora cactorum

Sequence
1005 bases(100 bases per row)
CGCGGCCGGCCCGCCGTGGACGTGATCGCTACGTACATGAACACGTGTGACCAGCGTACGGTGAAATCGGAGCTCATGCGTGCCCACGCGCACTTTGCCT
CACCTCGAGGTACGGACATGCTCTTTTGCTCTTGCCTGCTGTGGTTGAAGTTGAAGGCCATTGCGGCGCAGACGAAAGAACTGACTGTAGTGATTTGGTG
TTTTGTCGTTGACACGTTTGTGTTGCGTTGTTTGTTGCTGCTGTTGGTGAAGGTGGCCCGCCGTCGCGCATCCGTTCGTCTTCCATTATGAGCAAGGAGG
GCAGTGCTGAATGGGGCTGGTTCGCCGACATCGACTCGAGTAGCGAAAGCTGGGGTGGCGATGGTTCCATCCACTCGCTGCGGCGCCGACTAAGCGCTGA
CTTGGGACTCATCGACGTGGGCAACGTCCACGTCCTGGGTGATGAACAGACCAACACACGCATCACAGCAGCGCACAAGACGTTTACAATAGTCACGGAA
GGCAACAGCAAGGTGGTCTCAGCTACAGTGTCCATTCCCAAGTTCCGCATTGTGCAGTCACGCTCCGGCGCCGACCGCCACGCGCAGTATTTAATCACCC
TCATGCTCGGCAAGGAGCTGTACGCAGACTGGCGTCGGTACTCGGAGTTTGGTGAACTAGTGAAGACGCTGGATGAAAAGCGCTACACGCGGACACAAGA
TGCCTGGGCAGGAATCGAGACGCGCTGGTTCAATCGGCTAGAACCGTCGTATTTGCACCAGAAATGCATCACACTTGAGAACTTCATGCGCGAGCTCATG
TACGAGTCGAACGAGCCGAATGTGCTGATCAACTTCCTCGGCGGCTATCTGGGTAAGGTTAACGCGCGGCCTACGGACCCCGTGGCATATCGCCCAGCAG
CTCAGCTCCCGAAGGAGCTTCGTCCACCACAGCCGCAACACGAGCGAGAGCTGTTCGAGAAGATGTGGGCTGAGAACTTTAAACGGTCACATGTGGAGTA
CTCGA