Description :
From Genome Similarity Track
Location :
Scaffold_17:101501- 103196
Transcript NameFunction/comments
Sapdi_VS20SDRG_06217hypothetical protein

Sequence
1695 bases(100 bases per row)
TTGCTCGAGCACGTGGCGAGTCGCTTGGCGCGCACGTCGTACATTCCGCCGGCGTCGGCGCAGGACGCGCTCGAGACCGTCGTCAGCATGGTGCTCCGGC
TGGACCCGAGTCTGCGCGTGCTCGAGTCGGGTGACGGTCCTTGCTTGGCGCTGAAGGCCTCGGTGTCGCGGGTCGTGGCCGACATGGACGCGTCGCTACC
GAGTGAGCTCAGCGCCGTCATGGACGTTGTCGCGCGGCGGTTTGCGCGGCGAATTGCGTATGCGCCGATGCGTTTGGTGTCGATGGCGATGCAGCTCACG
CAGTGGGGCGTCAGCAACGTCGCGGACGTGCTCGTCGGTGTCCAGGCGCGGCTGCAGTCGGTCGGGTGCTTTGCATCGGCGGTCGTCGGCCCGGACGTCG
TCACGGCCATCGACCATGCGTGCTTGCTGCGGCCGGCGAGTGAGTTTGGTGCGCTCGTGTTTCTCCGGCGCGAGCCTCGCTTCACGTCGTCCAGTGACGT
CACGTCGCCTTTGACAAAGCCACCACCTGGCATGATCCTCTCGCCGATCAAGCCGACGATCGAGGCGTCCGTGTCTCTGCCGCCCGCCCTCGCGTCCAAC
TCGCTTTTGGATCTGCTGCTCGATTGGCATGCGATCACGCTCGGGGACGCCGTGCACGCGCAGGGCGAACCGATGGCCGTCACCCGCGTCCACCGGCACC
TCGAACGCGCGGGGTACATTGCGCCGGACCTGCTGCCACGAGCCATCTCGGTCGTCCTCGCGCAGTTTGCGTCGGACCCGAGCCTCGCGTTGGAGGGCGA
TGGTGACGACATGGTTGTCATGCCGATGGGCGACCGCCGTCTGTGGAGTGCGCCGCGGTCAACGCCGTGTGATGGCCCGAGCATGGTGCACGCAACTGTG
ATTGAGTTTATCGAGCTCATCGTCAAGGCGCCGTTGGACTACGTCGCCATGGCGCGCGTCGTCAAGGAGAAGCCGCGCTTTGGCTACTCGACGAGCAAGA
CGATGAAGCTTGTGCAGCAAGCGCTCTTTGAGACCGACTGCTTTCAAGTACTCAAGACGGGCGAGAAGGCGCTCGTGACGATCGCGCCGTGGGCCCTCAT
GCGCAAAGCGAGTGTGCTCGTCAAGCACGCGCTCCTTGCGGACTTGCTTGCTCGCTGGTTCTCTCCGCCATCGAATGGCGACCGTCCTCTGGACGATGCT
GCTCCGATTATCGACGGCCGCATCGAGACTTCGACGGCCGCGGTGGTTGACCGATGGGCCGTCGACGGCCCAACGACCGATGCAAATGCACTCGAGGCGT
ACGTGGCGGCGGCGCTGAATTGGCTGTCGACGCATGACGAAGCGTGTGGCGAAGCCGTCATTTACGACCTCAAGCTCGAGTACCCGGTCTTGCCTGGCGT
GATCAAGACGCAGATCCTTCCTGCACTCAAGCGCGACCCGCGATTGCAAAGCCGCCCAAGCTACCTCGCCGGCTTTTGCTTTGGGCCGCGCAGCAATAGC
AACACGAGCGCGCCGCTCTTGACGCAGGTGCTGACGCAGGTGCTGCCGCACATCAAGCGGTCGATGCTCGCGACGATCGAGAAAGGACGGCCGTTCCACG
AGTCGGACGTGCGCGGGCTGCTGCGCCCGCCAGCGACGCTGTCGCTCGACGTTGTCGTGCAGCATGTGCTTGGCGCGCTCCAACAAGAGCCCAAC