Description :
From Genome Similarity Track
Location :
Scaffold_2840:1015- 2534
Sequence
1519 bases(100 bases per row)
TAACTGGGTCGCCAAGTACGTCCGGACATGTGGAACATGTCAGCGGGTCAAGTCTGCAGGCCACGCATCGACCCCGTTTCAGAGCCTGCCCGATCCCAGC
GAGTGTTGGAATTCGATGAGTCTCGACTTTAGCTATCACCTGCCAGCTGACGAGCACGGTAGCACCGCCATTTTGGTGTTAGTGTACCGTCTGAACAATA
TGGTATATTCTTGCCCCGGTGCCGGAAACGGTCACAGGAGAACAGGCCGCACGACTGTTCTTGGACAACGTGTTCCGCCACAATGGTCTGCCGGAGACCA
TTGTCTCGGACCGAGACCTGCGCCACCATTCGTTCTCATTGCTGGAACCAGGTTGCTCATGTCAACCGATGACCAGACGGACGATCAGGTCAGACCGAGC
GCGTCAAtcgcgagctcgaggacaCTCTCCAGCGTGTCTGTGCGGAGGCGCCGCACTGGTGGACGGACACGTTACCCATGGTGCAGGCTAAACCGCACTC
CGGGAAAGCAAATATGAAATACCCGAGCTTCGTGGGGGAAACTCTCTCAATGGTGATATCGACTTTACCTAAGGATTCAGTCTTTTAGCGCGGATCCCCG
ATGCCGCGTCCGTCTCCCCTGGTTCTAGTCGCTGGaaacgagctctgcgcgcttgaggggaaaagtaagactgaattGGGCATCGCCTCGGCCCGAAAGC
CTTGGGCGATGCTTAAATATATGGTAGATCCTAGGATCTGCTTAACTACTTGTTTTCACTATGGTCCGACTTGGCTATACTATGGCCGCACTGTCTGCGG
TCATCAGCTGCGCTGTGCTGACTCTCCGGTTCTCTCTCCTTGGAAACTGGACGATCACTGTACTCGGAGACTTGGCTTTTTCGGGAGCACAAAACTATGC
CGGAATGGTCGGCTTCCCCGAAAACCCCGGGGCACTGTGTCACACATGCCGCGGAGCAATCCGTGACCAACCCGTCGCTGGGGCTGGAGACACAAGCCTT
GGTGTCTCGGAGGTCGCCGGGACCCTACGCTCCAGCGATGGAGTGAACGACGTTCGAGCTACATCCCAGAATCGCCGCGCCATTGGCATCCCTGCGCGAC
GTCTCCACAGGAGGTGCGTTAGTGCTTGGGGGCCAATTCtccgaggtgcagcagcgagagtaCGCGGACAGTCAAGTGGCGCGATGAAGGCCTCGAGGCC
CTGGGACGGTGTCGTCCCCGGACCCGTACTACCCGGAACGACGTCACTGGCCTATGAGAAATCGGCTGATGGAAGTGACCGAAGCTATCCGATATCGCCG
AGAGATCAACGTGTCCGGAGACCCGGAGCGCCCCTGGatgcagcggggctgcgtagcgtagtgcgtcagaggaagacgtatgactctccgatTTTTAGCT
TTgtggttctccgaacccctaagtctccgcagaggcttagatcactctagtatcactaactagagactcaacgagtcggtattcctaacccaaggtaaat
acacttTTTGATGCTAAAA