Description :
From Genome Similarity Track
Location :
Scaffold_113:1015- 2385
Sequence
1370 bases(100 bases per row)
GTCGTGCGGGATTCAGGTTCGCTGTCCCTCGCTCGGATCCCGCACTCCTTATAAAAATATGGGGCTTTTCAGCTTGTAGAGCCTCTAAGCGGCACCATAT
ACTTATTGATGATGGCTTGTCTACGTTGTTGCCAATATCCAGCTCCCGGTAATTGAACTACCCCTTAAGGGTATTGATCCACGTGCCTCCCGGTCCAGAG
TCAGTGCTAAACCACTACACCCCTGAGTCGATCGCGAAATAACTTCGAACGGAGACTTTACCAGGTACAAAATATTACAATTTAATTAGCAGAATGTCAT
CTACGTGAATAGTTTGATTCTGGTCAAACATTTACGGCATCGTTTCGATACCAGAAATGTTTGAAATAGACTATATCCCTTACGGGTTCAGGCGCTGAGC
GATATCTTTGCAGGGGAGTGAAGCAAATGAGGCAGATAACATGCAAGTGGTTTACTGTTAGACGTATAGAATATACTTTGTTCCTCTTTGCTAAACGTGA
CGTCGTGAAGTATCAGACCTCCTCTCCTGCACATCCGCTTGTTGAGGTACATGATGTCAGTTTATGTCCTTCGAAGATTAAGTGCACCTAGTTCTTACTG
TTAAATAGTGATGTTGGGGCGTGCTCGCGGGAGGCTAGACAACAAATGTGGCCAAGGAGCAGCTATCCCACGCCGCGATTGTGCTTAACCTCAGCGACTC
GCAGTTGATGCACGTCATTGACGCGGCTACTGCGAGAGAGGCGTAGGGAAGGTTGGCGCAATTTCATCACCCTCAAGACATGGCGAACCGACTTTGGCTC
AAGGAGAAGTTTGCCTCTTTTTCGTACACGGCATCAAGTATGAGCAGCCACGTCATGGAGATAGAATACCTTGTGATGAAGTTAAAGCGCGCAAACTGCG
GTCCAAGTGAAGAGGATGTATGCGCGGTGTTGCTGCGGAGTTTGCCCCCATGCTACGAGAGCTTGGTGCAGGCATTCCGCATGTCAGTGACCACCTTCAG
CTTCAGCAATCTCGTAAGCAAGCTGATTTCTGAAGAAGTGCGCCAGAAGGAGGCAGCACGCATAAAAGAAGCAAAGGCCCTCTACACAGGCAAGAAGAAG
GTCCAGCAGCATTCGAAGAAGCAGCAAGGACGGAGCGCTAAAGGACCATCGGGAACCTGCTATAACTGTGGCAAGGTCGGACACTACGCAAGAGATTGTC
GCTCAAGTCGAAGTCCAAGGAAGCAAGTGCATGATCAGTCAAACGTCGCGTTTAACGCCTGCGAAGGGTTCGAAGGCGATTGCTGGGTCATGGACAGCGG
AGCATCGGCACATATGTGCAAGTATCGTGATGCGTTTGAATAGTACGAGGAAGTACAGCATGCGCGCGCT