Description :
From Genome Similarity Track
Location :
contig_74:101480- 103496
Transcript NameFunction/comments
g11822.t1hypothetical protein
g11823.t1hypothetical protein

Sequence
2016 bases(100 bases per row)
CTTTGAAATTGGAGATTTCGTTCTTGTGGCTCAGGTGATTGGCCGCGTGAACAAGTTGGCCGTGCACTGGCGAGGTCCGCGGCGCATCGTCCGCGCTCTC
ACAGACTACATTTTCGAGGTGCAGGATTTGAGCCCGCCGTTCCAAGTCTCCACGCACCATGCATCACGTTTACAGCTGTATGCAGACAGTCGTCGCGACG
TCACGGAGGATTTGATAGCTCATGCTATGCATGCGGACGGTGGTCATCTTGTTGCCAAATTCCTCAAATGCCGTCTCGGTGCTGAGTCTCACGTGTGGGA
GATCGAAGTCGAGTGGGTCGGGCTTGATCCGCTCGAAGCATCGTGGGAACCAGCGGCAATCATGTTCGAAGACGTTCCCCGACTGGTGGAACAGTTCGTC
AACTCGCAGCCTGATGACTCAGCAGCTCATGCTATGTGGTCGTCACTTGTCGACGAACGTCCGCGCACACCCACGAAGAAAGGCAAAGGAGCCTCCAAGA
AGAGAGGGTAATGATCTGCAGCCATGCAGCAACGGTGTCGACCCGCCTCCGTCCGCCAATGGGCGGCAGCCAGCAGACAGCGAGTGGCAGAAGGCTGAAG
GTGACTCTGGGTTCTGGGTTGTGAGATCTCAGCCGGGCTGGAATATCATTTCTAATTTGTACCCACCGAGGCGTCGCACTGCCACTGGCAGTCTGCCAGT
GCGGCACTGGGGAAGTTTGTAGTAGCGGCGCACCATGGCTAGCGTTAGAAGGAGGGCACGCAGTGCAGGCAAATTCTAACGGAGCTCAAATACATGTCAG
TTTGAAATTTCCTCCCTAGTGCGCAATAGAGGAGGTGGCTGGGGCTAGCCGAGCGCCGAGCCAGAACACTCCTGGATATTGCAAGGGGATACTTGCAGTA
TTGGCATACGTGAATCTCACGCTTATCAAACCAATGAGTCATGAATTTGTTGGCGCAAACGTCAACTGGTGACCACGAGAGCCTCTCGGCACAACCGAGT
GGGTGTGACTCATTCAGGGTTTTCCCGCCTACCCCGGGAGCGTCATGGCTCTCCACTCAAACCCCTTTTCAACTGACCGAGTTCCATTGGTGTCCCCTGC
GATGAAGACCATCGCGGAGAAATCAATTGATTTTGTATTTGTTGCGGTTTACCATGCAATCTACTCTATGCCATTCTGCTACTGCTGCTCTCGCCACGAC
AACCAATTGTCCAGCGCTCACAGCCAGGCACTAACATCCGAGGAAGCAAGATCAAGAAGGCCAAGCGGGTGACTTTCGAGTCCAGCTTGATGAGCTGTGG
CTGCAACTCTCGGTGACCGCTCTTCAACAATGCCACGGATTAGCTGATCTCGCCCAATGTTGAATCCGAAGAGTCCTCGGATTCGTTATCCTCGGCGGTG
GCAGCACAAGGAGCGTTTGGGAGCAGAGGGATCTCGCAATCCAACAGCAAAGCACTTGTACTTTACCTAGTACAACGTACACATTCGGGTTCAAATACTC
TGTTACTTTCCCCATACAAAACCTCCTGGTTTCAAACTCTATTGAAGTAAAGTTGTGGAGAACTCATTAGTAACATCATCACTAACATGCACTAAGCGAC
CAGACCAGACGAACACCAAGATGTGGTGACAGGCTCAGATTCATCTGTAGCATCTCTCGCTAGTCGAGCGTAACGTTCCAATTAAAACTCCGCCGCTATC
CCCCACCAGTGCGCGTCCGACTGCCAGTCACTTTGCATTTCGCCCTCAACAGCTCAAGTCTCCCACACACACACGTTTCGACCGACCACGATGAACCTAC
GCGATTTCTTCGTTGCCGCTGCAGTGTCGCTCGCTTTCGCCCAAGCGGATGTGATCTCGCACGATCAGGTGGTGCCTTTCACTCAGCCCACGCCCACGAC
GACGGAACAAACGGCGGGCATCAAGTTCAAGCCGCAGATTCACATCTCCAACGGTTGCCACCCGTACCCTGCAGTGGACGAAGCTGGCAACACCAGCGGC
GGACTCAAACCCACGG