Description :
From Genome Similarity Track
Location :
Scaffold_450:10148- 13534
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_450-fgenesh-gene-0.8Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_450-fgenesh-gene-0.2Pantothenate kinase

Sequence
3386 bases(100 bases per row)
GCTCTTCTTCACAGGGAGCGCATTCGCTTGAGCGCGTTGGCGCGGGACGAAGATTGCGGCTGGCTCACCGGAGGCGTCCCCGGCCAGCTCTTCCCGCCGA
GCTTCGCATCCTCCTGCATCCGGCGGATGTAGCTCGAGCAGGAAGGCACGTCGAGCGCGGCCTTGTGCCTCGCGGCAGTCGCTGCTGCTGACGCGCCGCC
GTCCGCGAACAGCGTCGGGTCCAGCTCGTTTAGGTACTCGTCCAGGTTGCGCAGCATCATGTGGTCGGCCACGGCAGTCGTAGGCTGATGCTGTGCCGCC
CGCGCGCGCTCGAGCTGCAGCTTGCGCACGAGGAACTGCTGGATCTCATCGTAGCAGGAGCGCGACCGCGCGTCGTTGACGCTCAGCAGGTACGCCTGGT
CGCCCATCTGCACGTGCTGCCGGATGTACTGCTGCACGCGGTCCATCTCGAGCTGGTACTGCGCGGTCGAGTCGAGCGGCGCGCTCGCGGGACGCGGGCG
TCGCTGCAGCGGCCGCGGTGCAGGAGCGGCGAGCACTTGTGGAGCCATCGAGGAGGCGGTGGTGTGAGGTGAGCAATGGCGCGCGAATCAGGCAATGGGC
TGGCGGCTCTTGCCGTATCGCGGCGATTTGTCCACCCGGGCGAGCGTGACAGCAGTCCAACGCATGTTACAGACAGCGGAGCGGCCAGCGGGTGCCGCGG
AACAGCCAATCACGATGTCACAACGAACGCTACAGAGCGAGAAACCCGGGTTCGCCGTTATGGATTCTGGGAGCACCAGCTGGAATTTCAACAACCAAAA
AGCCAAAAATCGAAATTGGCGTTGCTACAAAGCGCAAGTGTCACGCGCTCTCTTTCGTCGAAATATCGAATTAAAGCGGTGGATACCATCACTCTCGTCA
GCACCTGTGCTGCCTGGCTCTTTGCACCGCCAATCCAGCATCATCCTTTTGCGATGATGATTTTCGTTGGATACTCAATGCCGCATTTGCCTAACGCTTG
AAGCCCGCATCAGTGGACCTGAAGTGTTTTGACGCCGTTCATCCGTGATATCTTAGGTGAGCAGCCGCCGTGGACCACGGTCAACACGAGCTGCCGAAAA
CACTTCCGGGTGAATGATTACGGCGGAAGGAAAGCGAACTGAAGTCCGTGGCCAGCATCCACTCCGGCTTCGGGTGCCGAGTCAGACGCCCCTGATTTTG
CATTGTCGACCGCCCGTGCGCCATTCGAACGGCGCACAGGCTCCAGTCAGTGGCGCCATCGTTGAACGATGTCGCACTTGGACGCTGCATGCAGACGTTG
CTGCGTGCGAAGTCACGTGGCGCATTTTTTTTGAAGTTGCACAATTCGATTTGAGTGGATTCTGCCCCGTCGCGAAAAAAGTGTTAAAAAAAACAAATTT
GTGCTAGATACTGTCAAAATTCTGCTGAGTTCGGTTCACTTCGATTGGCTATTTCGCTAGTGTTTTCAGCCAATCCGATCTCCCTCCCTCACCCGTCAAG
TTCAAGACCGCAGACGTGGGCGGCGACGGCCATGGCGGTGCTCGCTGGTGCCGCGCAGCGAGCGCTCGTGGCCGGCGGCTTCGTGCTGCTCTCCTCCTAC
GTCGTGCTTGTCTGCGTGCAGCGCAAGGGCGAGCGCCACCGGCGCTGGCGGAAGCGCGTCACCTACAAGAAGCTCTCGAAATCGTGCGGCCCTCCGCTTC
TTTTTTGTCGAAACATGTCAGACATGCGCCACCCCGACTCACTGCTGCGTTTGCCGGTGCAGATCCGACCTGGGCCACTGCTTCGGGCTGGATATCGGTG
AGCTGTGGTGTCTTTGGCGCGGTCGCTGGCGGGGAAGCTGATTGCGGAGTTGCAGGCGGAACCTTGGCCAAGATCGTCTACTTCGAGCAGAACGAGTCGT
CCGACCACCGCAAACGGCCGCGGTCGCTATCGCATGACCTCGCGGTCGGCGAAATGACGCAGATCCTCGAGCAGAACGAGATCTTCGGCAAGACCGGTGT
GCAGGACGTTCGCTTGCGCGTCCACTCCAAGCACCTCGGTGGTGTAAGTGCATGCAGCTCGTCATTTGGACAGGCTCCAGTTGGAACTGATGATGGAGTG
TGCTGTACGCCTCTCCAGTTCTTCCACTTTATCCGGTTCGAGAGCAGCAAGACGCGCGAGGCTATCGACTTTATCGCCAACACGGGGCTGAATCAGTCGG
TGCGCAAGCTCCCCTGCACCGGCGGCGGCGCTCACAAGGTCTGCACTGGCAATGTGATCTTGACTTGACCCATCGCTTGGAGTCTCATATATGTGTATCC
TGGCGGGATGGGATGCAGTACGCGCCGTTGTTCGCGGAGATGGCCGCGATCGACCTGGAAAAATACGACGAGATGGACTGCACCATCCTTGGACTCAACC
TTTTGCTCACCACGATGTCGGACGAAGTGTACACGTTCGAGGTGCGTTCTGTTCTGCTTGATATGCAATATGGCATGGTGCTCTTGGGGCTCAGATCGGC
GTTGTGATGTTGCTGCTTGGGTATATCAGGACGTTGATGCGAGCTCGTTTGCTGCCTCGCGAATGAAAACTATCAAGTACGATGTGAACGAGAACATTTA
CCCATATCTGGTACGTCGTCTCCCAGTCTGTTGCATCCAAGCTCGGTCGGTATTGAACTCATCTCCTTCCTCAACTTGTTGATAGCTTGTCAGCATTGGC
TCGGGCGTCAGCGTGATGTACGTCCGCGGACCAGGCGACTATGAGCGTGTGAGCGGCAGCAGTATCGGCGGCGGAACCTACTGGGGACTGTGTCGCTTGC
TGACCAAGTGCCAGTCGTACGACGAAGCTCTTGATCTGTGCGTGCACGGCTCGAACCAAACCGTGGATATGAGCGTCGGCGATATTTACGGCGGCTCGTA
CGACAAGTTCAACCTGCCGGCCACGACCGTCGCGAGCAGTTTTGGCAAGATGATCTCGGCTCCGCGCGAAAGCGCGAGCGACGCCGACATATCACGGGCT
CTGCTCGTCATGGTGACGCAGAACATCGGCCAGGTCGCCTTCCTCAACTCGTGTCTGTACAAGACCAAGCACATCTTCTTCGTCGGCAACTTTTTGCGAC
ACAACCGCATCTCGTCGCACATGCTTGCGTACGCCATCAACTTCTGGTCGAAGGGCACGACCCAGGCACGGTTCTGCAAACACGAAGGGTACCTCGGCGC
GCTCGGCGCTTTCATGCGCAACGCTGAAGTCAACAACGTCCACGGCGAGGAGTTTGTATCGGCGACGCGCGATCCGTCATTCTCGTTCCAAGCCCCCCAA
GCGCAGTAATGAGCTCGCGGGTGTATAGAGTGCAGGTTGGATCGAGGTTTGCTTTGCGTTGGTACACTTCAAGAAACAACATTGGT