Description :
From Genome Similarity Track
Location :
contig_74:101460- 103475
Transcript NameFunction/comments
g12379.t1hypothetical protein
g12380.t1hypothetical protein

Sequence
2015 bases(100 bases per row)
GCAAAGGAGCCTCCAAGAAGAGAGGGTAATGATCTGCAGCCATGCAGCAACGGTGTCGACCCGCCTCCGTCCGCCAATGGGCGGCAGCCAGCAGACAGCG
AGTGGCAGAAGGCTGAAGGTGACTCTGGGTTCTGGGTTGTGAGATCTCAGCCGGGCTGGAATATCATTTCTAATTTGTACCCACCGAGGCGTCGCACTGC
CACTGGCAGTCTGCCAGTGCGGCACTGGGGAAGTTTGTAGTAGCGGCGCACCATGGCTAGCGTTAGAAGGAGGGCACGCAGTGCAGGCAAATTCTAACGG
AGCTCAAATACATGTCAGTTTGAAATTTCCTCCCTAGTGCGCAATAGAGGAGGTGGCTGGGGCTAGCCGAGCGCCGAGCCAGAACACTCCTGGATATTGC
AAGGGGATACTTGCAGTATTGGCATACGTGAATCTCACGCTTATCAAACCAATGAGTCATGAATTTGTTGGCGCAAACGTCAACTGGTGACCACGAGAGC
CTCTCGGCACAACCGAGTGGGTGTGACTCATTCAGGTTTGTGCCGCCTACCCCGGGAGCGTCATGGCTCTCCACTCAAACCCCTTTTCAACTGACCGAGT
TCCATTGGTGTCCCCTGCGATGAAGACCGTCGCGGAGAAATCAATTGATTTTGTATTTGTTGCGGTTTACCATGCAATCTACTCTATGCCATTCTGCTAC
TGCTGCTCTCGCCACGACAACCAATTGTCCAACGCTCACAGCCAGGCACTAACATCCGAGGAAGCAAGATCAAGAAGGCCAAGCGGGTGACTTTCGAGTC
CAGCTTGATGAGCTGTGGCTGCAACTCTCGGTGACCGCTCTTCAACAATGCCACGGATTAGCTGATCTCGCCCAATGTTGAATCCGAAGAGTCCTCGGAT
TCGTTATCCTCGGCGGTGGCAGCACGAGGAGCGTTTGGGAGCAGAGGGATCTCGCAATCCAACAGCAAAGCACTTGTACTTTACCTAGTACAACTTACAC
ATTCGGGTTCAAATACTCTGTTACTTTCCCCATACAAAACCTCCTGGTTTCAAACTCTATTGAAGTAAAGTTGTGGGGAACTCATTAGTAACATCATCAC
TAACATGCACTAACCGACCAGACCAGACGAACACCAAGATGTGGTGACAGGCTCAGATTCATCTGTAGCATCTCTCGCTAGTCGAGCGTAACGTTCCAAT
TAAAACTCCGCCGCTATCCCCCACCAGCGCGCGTCCGACTGCCAGTCACTTTGCATTTCGCCCTCAACAGCTCAAGTCTCCCACACACACACGTTTCGAC
CGACCACGATGAACCTACGCGATTTCTTCGTCGCCGCTGCAGTGTCGCTCGCTTTCGCCCAAGCGGATGTGATCTCGCACGATCAGGTGGTGCCTTTCAC
TCAGCCCACGCCCACGACGACGGAACAAACGGCGGGCATCAAGTTCAAGCCGCAGATTCACATCTCCAACGGTTGCCACCCGTACCCTGCAGTGGACGAA
GCTGGCAACACCAGCGGCGGACTCAAACCCACGGGCTCCTCTAGTGCTGGGTGCAAGGGCTCCGGATACGGCAGTCAGATTTACGGTCGCATCACCACGT
ACGAGGGTGTGTATGCCCTCATGTACTCGTGGTACTTCCCCAAGGACTCCCCCGTCACGGGGCTGGGTCACCGCCACGACTGGGAGCACGTGGTCGTGTG
GGTCGACGATATCACGCTCGACAGCCCGTCGATCATTGCCGTGTCGCCGTCTGCGCACAGCGGCTACAACATTTACTACCCGCCCGAGTCCAACACGATC
GATGGCTACAGCGCCAAGGTGGACTACTCGTCGAGTTGGGTGGTGGTCAACCACGCGCTGGACAGCACATCGGACTCTGGCGAGTCACAGGACTTGATCA
TGTGGGACCAGCTGACGGATGCTGCGCGTACGGCGCTGGAAAACACAGACTTTGGTGATGCCAACGTGCCCATGAAAGACGGCAACTTCTTGACCAAGCT
GGGCAACGCCTACTA