Description :
From Genome Similarity Track
Location :
Scaffold_57:101457- 105270
Sequence
3813 bases(100 bases per row)
CATCACCTTCTGACGTAACAACGTTAATGCAGGGCCTTTGCAGTCGATTTCACCTCGCACTTGTCTGATTATTAAATTTGAGTCTCCACATATCACCAAC
CTTTTCGTGTCTTCATCCTTTAGTAGATCCAACCCCAACAGGAGTCCGTTGTACTCCGCTTTATTAACGGTGAGGCCTTCCGCGTACGTGGATCTGGCCC
TTACCACTTCCCATTCATGTAGTCCCCATAGAATTGCGCTGTAAGCCCTTCCTCCGCGTCGCACGCGGGCGGATCCATCGAAACTCAGAGCGTATAGATC
TTCATCCACTTGCACCGTCGGGATCGCGATCTGAGGCTGGCGTTGGGGCTCTTTCTTAAAAATGATCCTAGTCAGTGCTTCGTCCATCTTGGCTCCGGGC
GTGATGCTCGCGGCCAAAACTCCTAGGATCTCGTCCTCTCCTTTCCAACATTTGACGATCTCCAGTGTCCATGGTGAGAGCAGGTATACCCATTGTCCCA
GCCCTCCTTGCAGTCCGGCCGACTTAAACAGCCAGGCAAGCGTGGAATGACGCGTCAGGATCCGGATGGATCTCCCCACCAGCAGGTTATAATTGAGATC
CAACACCCGTAGAAGTGCCAGTATCTTCTTCCCCACTGCACCGTAATTCAACTCGTTAGGCTTTAGCGTTCGGCAGACGAAGGTGACTGGATGACAGATC
CCCTCATGCTCTTGTACCAAAGCTGCCGAGACCGCCCAATCGCTAGCATAGACTATCACTGGAGGCTGGCGTTCTGGATCAAAATGGCGAAGGATATGCG
TCGTCGCGATCCAGTCCCTTAGTTCCACACACGCATGTTAAGCTCGGATCCACCGGGGTTCCACTTTGTCTGAGATCCCTTTCGCCAACTCCGTCCCGAT
CGGATCCTCTTCCGGTTGGTCCTGGGGTGGATCCAGTTCTTGCTTCAGGTCGCATCCTGACGTCGTGCCATGTGAATCCCATGTGGATCTGGGATTTCCA
GGGCCAGAGCTTGATGGATCTTGGTCCGGACAGCCTAAGTAGCCATTGCAGCGAAGTCCACCTCTCCTAGTTCATAGAGGACTGCAGCAAAAAGTGCGTA
ATCCTAAAATAACCGACTGTAGTACTTCAAACTGCCCAAGAAAGATTGCATCGTCCGTAGCGATTGCGGGAAAGCCAAATCTGACAACGAAGACAGGTCT
TTAGGATTCGCCTCCAATCCCTCCTTGGAAACGCGATGACCCAAGTAATCCACCTTGCGCGTTCTTTCAATAACTCTTCACCACGCCGATAGAGAGATTC
CACTGAGTACACGCCTCCAGTAGGGATGTTACTCTCTTGCATAGCTGACTCCACGATTTCGCCGGGATTGCATGTCGTCGATATAGGATCTGCGCCCTAA
CACGGATGGTGTCCCCAGATCACCTGGCTCGCCTGCTTCGAATGGATCTACTTCCGCTTCACCTTCTCCGGATCCACGCCCTTCGGGTTCCGGGATTCGA
GTAAATCCGTAGAGGGCATTATCAATCAGACGTTGGTAGATCTGGGGTGCATTTTTCAATCCAAACGGCATCCGGTTCCATTTGAACAGTCCAAATGGTG
TGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTCATCACCCAAATCCACTCACCATGTCTAAAGAGCAGTACCAGAGTACTATATCCAAATCC
TCCAATAGCTCATTAACTAGAGGCATCGGGTACACCATCAGTCTGGTCAGACCGTTAAACATCCGGTAATCAATACACATACGTAAATTCACCCCGTTCT
TCTTAATAATGATCACCCCAGGAGACGCCCACGGGGAGGTTCAGAAACGGATGATTTTGGCTTGCAACATACCTTTAATCAGATGCGAGAGCTTTTCTCG
GAACTGAGGCGCCACCTTCCGCACCCTTTCAGCAATCGGCTTCGCGTCACCGACATCGATGTCACATTTGACTCCGCGTGCGGCTGGTGGTAATGCATTT
CCTTTACCAATTAACAGATGTCGGCTTTCCCAGATTCTCTTACATAGTCGGCCCACTTCCGCAGGTTTAATCGCTCCGGGATCCACCTGGATATCGTCAA
TCGTGACTTCTTCTGTGGTCAGTGGCACCTCCAGGATTACCGTAATGCCTTCCCCAAGATCTTCGGCGTACAGAACCCCACCTTCACGGTAACATACCTA
TTCATCCTCAGTCTTTGTCGGATCCATCACTGGATCTAGGCGTCGCGATTTTCCCTCTTCAATAAGCCCTTCTGTTTTCATGGAATTGGTTATTCTGGTA
CCAAGGAAAGTGTCTTCTGGATCGACTTTGTCTTTTGGTATACTTACACACTACGGCTCCCGTTTAACCAGTGTCGACACTCTCGACAGGGATCCATGCA
TTCGGTCCAATGAAAAGCTCAGATCCAACAGCGGATTAGCAGGATCCAATGGGCCGGGTTCAATCGCCAGCGATCCCCCATCCACCGACCCTCGGTTACC
TGGGGACCGGCTCTGGGTACCTCCAGCTGTCTTGGATCCAACCTCCACCACTTGGATCTCAATCCGACGATCTCTCAGTAAGCACTTCCGCGGAGTTGGA
TATGAAGGCCGGTCTACCAAGGGGCCAGTCGGCTCCGCCGGGGCTTCCACATCCCCGAGAGGTTCAGTCTCGGTAGTACCTTCATACGCCAGGTTCTGCC
ATTCTCTATAGCGACGAGATCCAACTGACACATACCCAGGTCGCCTTGGAATACCATCCTTTGCCAGCCATCGTCCAATTTCCTCATAGTGATCTAGTAA
TAATCTCTTGTCGCTGACATTCGTAACCCGGAGGTACTGCGATAAACCCGATCCTTGGATAACTGTAGACACTCACTTCTCGCCCCGAGTGACCCACAGT
TTCTCATGTTCCACCCACTTCATCCGATCTGGCAATTCCCAGATTTCCCCGGTCTCGATCCACGTCATTTTGTCTGCCCTTATGATCCCCATCTTTGCCC
CGTACAACGGTCGTCGCCCACGGAGCTGGATCCGCATTTTATCTGGGAAGCACAGTGTCCCATCTGCCAGACCCAACCTTACCCCGGCTGTTACCAGGAA
ATCCATTCCAAGAATAGCATCTTGACCAGCGAGGTCTCCGACCCAAATATCGAACCAGTACACCAAACAACTGGCCAACGTTATCTTGATCCGCGCTCTT
CCATTCGTACGGTACACGCCTTTATCAATCCCAACACAACCTTGGATCCGACTCCCATCCACTTGCATACAACCTTACGAGCAAAGGCGGTATCTAGTAT
AGACACCTCGGCACCACTATCTAGGATAGAATCGCTTTTTCATTGTTGACCTTGCCTCCTACTTTGGCTTGTCGAACAATTTACTGGGGCATGGTATTTC
CAGTTTCTACGGGATTCTCCTGTCAGCAGATCCATAGATCCAACATCTTCGGATCCACGGGATCCAGTGACCTGACAAACTTTAGGTGGATCTTCAATGA
CCTCGTTTTTGGTAGGCTCAAATCATTGGCCATGTCGTCGTTTCGCCAACTAACCGCGCGATTCTCCACTTTGTAGATCCAGGGTTGAAGAGACTTCAGA
TCTGGCAAATTCATCCCCTTGGCGCAAGCTAGAGACCTTGGCAACTGACACTTCATGTCTATCACGTGTATTATCTACTGGATCTAGGGGCCTGCTACCT
GGACCTAGCGACATCTTGTTCACAAATGCATCAATGCAATATCTGGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCGTAGTTTAACATATT
GTGTGGTGTTGGA