Description :
From Genome Similarity Track
Location :
Scaffold_118:101453- 102469
Transcript NameFunction/comments
g6203.t1ETL94876.1 hypothetical protein L917_07245 [Phytophthora parasitica

Sequence
1016 bases(100 bases per row)
GAGGAATGGTCCTTGAACAAGACGAGTTGGTATTTCAACGGCAAGATGTACCAGAAGTACGCGTCGCTGTGCCTCTTGGCCGCGGACGCTGCTGTCGTGG
GGAAAGATAAAAAGCTGCTCAAGACTTGCCTCACCAAGCTGGAGACGCTCATCGAGCCCTTCCTGAACAACACGCTCGCACCTGCTCTCAACTATGAGAC
GTCGTACGGTGGTCTCGTGAGCAGCCTGGGGTTCACCGTGAACGACGTGAACGCCGACTTTGGCAACACCGTGTACAACGACCACCACTACCACTACGGC
TACTGGGTGGCGGCTTCTGCCATGCTCAAGAGCCTCGACCCCAAGTGGGCGCGCATGAAAGACCTCGACTCGATGATCTGGATGATGCTGCGCGACGTGG
CCAACCCGAGCTCCGAAGACGCCTTCTTCCCCAAGTTCCGCCACTTCTCCTTCTACCTCGGCCATTCGTACTCGCACGGCGTGACTCCGATGCTTGATGG
CAAGGACGAAGAGAGCACGTCCGAAGACGTCAACTTCTACTACGGCATGAAGCTCTGGGGCCAAGTGTCCAAGAACAAGGCCGTGGAAGACCTCGGAAGC
CTCATGCTGCGCCTCAACGCGCGCGCCATCCGCACCTACTTCCTCATGACGTCGGACAACACCATCCACCCCAAGCAGTTCGTACCCAACCACGTGACGG
GCATCTTCTTCGACAACAAGGCGGCGTACGCGACGTGGTTCAGTGCCGAGAAGTACGCCATCCACGGCATCCAAATGATCCCCGTGTCCCCCATCAACGC
CATGGTGCGTACTACCAAGTTCATCCAGCAGGAGTGGGAAGACATTCTGTCCAAGGAGCCCATCGTCACCGAGGCCAACACGACGAACGCTTGGCTCTCG
CTCCTTCTAGTGAACGAGGCCGCTGTGGACCAGGAAGACGCACTGACCAAGCTCCAAGACGCCACCATGGACGACGGGCTCACCCGCTCGTGGGCATTGT
ACAATGCCGCCTCGCG