Description :
From Genome Similarity Track
Location :
scaffold_324:10144- 12379
Transcript NameFunction/comments
g7264.t1 DNA replication licensing factor MCM5

Sequence
2235 bases(100 bases per row)
CTACTTGACGCGGGACACGAACTTGTACTGGCTCAGTTGACGCAGCGAGCCCTTCTGCACCATCGCTCGAATTGCACGTTGAATAGCGTTGGGATTGTAT
CCTTGAGCCTCCAGACGGCTGTACAAAGCGCTCGTCTCGACACGCGTACCGATGCGCAAGGTGCGGTTGATACTCTGCTCCACCTCCTGGGCTTTCTCGT
GGAAGCCTCCAAAGAGTCCCTGGGTGCCGCCGTCCTTCGCAGCATTCATCGTACTCACGCTGAACAACCGAATCGCTTCCTGTACGTGTTCGCGGGTGGC
TTCATTGAGCAGGTGCATCTTCGCCAAAGACTCCGAGATGCGCACGAGGGCCTCAAGCTGACGCACAGTAACGGGTATCGTCGTTTCACCGCCCTGAGTA
CGCCGCACATCGTCACGCACGCCAACGTAAAAGTCCTGTAGCGCCTGTGCAGCTCCAACTGAAAGTCTCGGCGCGCATCGCGTGCGGCAGTAAGTGATGA
ACTTCTTCAACAGCCACGGCTCAAATTCTCCTCCACCGGAAGCACTTTCACTAGCCGAAGGCTTCCCTGCCGCCGACGCGAGTGCATTCGTATGCATTCG
CACAACGTGAGCAGCCATTTGTCTATCTCTTGCATCGTCCTGGATGTCGCGCACAATGAAAATCATGTCAAAACGACTGAGAATGGTGCTCATCAGGTCG
ATATTCTCCGAAGCTGAGCGCATATCATCGTAGCGACCGAACACGGGGTTAGCAGCCGCCAGAACGCTTGCACGCGAGTTCAAAATGGTGGTGATACCGG
CCTTGGCGATGGAAATGGTCTGCTGTTCCATGGCTTCGTGAATGGCTACACGATCCGACTCACGCATCTTATCAAACTCGTCGATGCACACCACTCCACC
ATCGGCCAAAACCATGGCTCCTCCTTCGAGATAGAACTCGCCCTTGGAATCACGAATCACTGAAGCCGTGAGACCAGCAGCACTACTACCTTTACCGGAC
GTATAGACGCCCACAGGTGCGATTTTCTCTGTAAATTTCAGGAACTGGGACTTTGCCGTACTGGGATCTCCCAACAGCAGCACGTTAATGTCACCACGTA
ATATCATTCCATCGGGCAGTCTCTTTCTCGATCCACCAGCCAGCAAACAAGCAATGGCCTTCTTCATGTTCACTGTGTAGTCACCGTAAATGGACGGAGC
GATACTGGTTGCCAATTTCTCGTACAAATTCGGATCTCGAGCCATTTCATGGAACTTTTCCTCTTCAGCAGGAGAAAAAGTGGACTTAGCACGTCCTGCT
CCTTCTTCGTCGATCTCAATACCTACCACACGCAAGTACAGAGTGCGGATGGCTACAGCTCCGACGTTTCGGCCGCCTGCATTGACGACTGAAGTGATGC
CGACCACCGAAACGCGCGTGCCGGGGGATGCTCTGTCGACTAAGTGACGATCCGCAATCAGCGCCAAGTTACGTGGCATTTCACCAGTAGGCACCACTTC
CGGGTTTTCCTGCAACTTAAGCGTTTGTTGGTCCACGTATTCTCCTTTGTCTGGCAAAACCATGTACGAGTCTTTCGGACAGCCGTCCCCAGGGGCAAGG
TTCTCTTCCTCCCGGTTGCGATCACAGATACGGGGGATGCTCACGCCACCCATTCCAGAAACGGCGACGCGCTTAGTGTGGCCACAGTTGCGGCATCGTA
AAGTTGCCGATACACACTTGGTGCGCACTCGAGTGGCACTGATGACAATTCCGGGTACTTTCACCAGGCGGTTGATTTCCTGGGCGTGAACATGGCGAAG
CGCCACTGGGGCTTGGTCACTGGTGAGAATGGCTTGAATGTCTGGCAAATTTGACGCGCGAAGAGCTGCGTTATCAGACGCATCGGCAACTGCCTCTTGC
CCTTGCGTGCTGGCGACGAGCAGTTGCGCCAACATTTCCTTGGCTGCATTTTCCAGTAAAGGTAATTGTTCTTTCGGGTTCTTCAGCAATAGATCTTGTA
GTTCCTGGTCGAAGGCGGCAACATGCGAAAGGTTCACAGTCACGACCCAGTGGTGGCGGCGGGCGTTGGCCAGGAGCTGCTCGCGGTAGTAGAAGAGCGG
ACCCACGCGGAACCCGCGCAGGAAGGCCAAGAGACGACGCTGCAAGGCCGCCGGACTCGCACTCTGCCGCGCGTCCGACGCCTGCGCGCTTTCCATGCCC
ACGGCCGACACGCGACCGGCATCCCAGTCCATTGT