Description :
From Genome Similarity Track
Location :
scaffold_7:101439- 103877
Sequence
2438 bases(100 bases per row)
ACATTCGAACTGAATGTGTAACCAGCCGAAGTGAACAAGTTTCTGGCGTCTGCAGGCACGTGACAACTCTTCGACGAGCTACTGAGCAGGAACGACGCGT
GAACGTATCCGTGCACTTCCCTAGTGCAGTGACAATCGAGAATGGGCGGGTCTAGCAGCAGACAAGTTACCAAGGGTCATATTCAGGGATTGGTACATGT
ACATGTAGTAACATCTAGAATAGTACTACACACTAATAATAATTCTCTGAAATAAATTTCAGAGATACATGCACACCATTTTTGACGACTCCAATTTTAT
ACTTCCAGACCGAATTTCGGGAAACTGAAAGTATCATCGAGTTTGTTCGTGTCGCAATCATAGCGCACTTGGTTTTAATGAGGTCCTCTATTTGTGTTTA
CCTGGAAACTCTAGATCCCTGACAGTCGCTGGGGGCGTCGAAGCCCAATATCTCTGTGGGATTTTAACCCAATGTTGATGTATCGAAGCCGTGGTGAACG
GCAGATGAACTTTATGGAAGCAGGAGGGTCACCAAGACCTCCCGCCACGGTGGATCACGATAATCGAGCAACACGAAGGCTCCACCAAGCCCCCCCCCCC
CCCCCCCCCGTTTAGGTGGGCAGACTTGAACACTTGAGGGTCACCCCGTCCCCCGTGGTTTGGTGCTGGATCGGAATCGCGCCGAGGCACCAGTTCCGTC
GCAATGTGGTGGGAAATTTTGATCACAGGAGGGGTCACCATGCCCTCCGCGCCTTGGTACTTAAGCAGCTTGATATAAGTCCTTGCTCTCCTCTTCCAAC
TGTCCTTTGAAGTCAACACACTTTATCGAAGCAGGCTGAACTGGCTGGGGCACGTGGGAGGATCGCAGATCCGCTGGCACAGCTTCCGGGGGTTAGTACG
CGTACCTTGAAAAGTGTCTAGGGCGGTTGCTTTGCAGCTAAGCACATGCCGCGCGGGGACAGGGGGCAGAGGACCCGGCGTCTGGACGAAACATAGTGCA
CTTGTGTATCGAGTATCTAAGAGCTAGGCAGGTCAAAACAGACTTTAAAACCGACGTTAACTACCGGTAGCCCCTTATGCCAACACAGATGTAACGCATA
CTATAATGAGCTTGCAGTCTTGCAAGTGTGAGGGTGTATACATGTACTAAAAATAATATAATAGTTTGAGCGCCTACGTTCTAACACGCCTGTAAGATAG
ATATTGTATTAACCCTTTCGTGAACGCTGGGTCTTCACTCAATTAAAGTATAATATACAAACCAAGATGTTAAGCTGTGAAAGGGGGCATTTTGCCCCCT
TTCATAAACCACGGTACTCGCCTTAAAACAGTCCTTTCTGGATAGTGGAAGGAGGATGGGATTTAGGAGGACTAGGTCGCGAAGTTATGATGAAAGGGAG
CAAAATGCCCCCTTTCATACGCCACGGTACTACCCCACCTGGCAGCTGGTCATTTTGCTGATTGGTCTAAAAAAAGGTTTCCACCGCTTTTCTGACGATC
ATGACACTTGAATGGCTGTTCGTCCGACTGGCGTGATGGCATAAGACGGCAGATCTTGAATCAGATCCCGAAAGATATCAGGTCCCACTTGAAATCTATC
GGCGTCAGCCATCCGTGTGTGAGAGAGGACAAGAGTGTCCTATATGCTACCGAATTGCATGAAGTAGCGAAGACCGACACCTGCACCAGCGATCGCCGTA
CTGTTGGCGACCCTGCACAGATAGTTCTCTTTTTCACGAGTGGAGTGTGCGAAGTGCGTAACTTTTCATCACCTACTGTACCAAGCTGGCTGTTCTATCA
GTAATATGCTCATGGCTTCAAAACGGCGAGTTATGCATTTATCTTGCTTTAACTATGCAAATAGCGGCAGCTGTTGACGATCGCAATTGACTGTTCAGTC
TCAAGAACACCTCCGACGAACATGGAGAGTCATCAGAGTGATAACTTAGGCGAGGCAGCGCCTGGTGACGGCAGTAGCGAGAGCGAGAACCTCGGGCGCT
TGCTCGGGCAGCGTCCGGCGGCGGCGGCAGCGAGAACCTTGGGCGCTTGCGTCAGGCAGCGGTTGCTGCAAGCGGCAGTGCTTGAAGCGATGGCAATACT
CGGAGCCCTAATGAGAACGCAACTGGAGCTGCTCAACGTGTTGTTGAAGTTGTACCAGCCATGGAGAATGCCGAAGGTGGTCCAGCGTCAGCGCCGAAGC
GAAAGCGGGGCAGACCGAAGGGCTCAAAGAATAAGCCAAAGACTACGACCGACAGTGAGCCTGCACGAAAGCGCGCCCGTCCGGCAAAGTCCAAGGCTTC
ACCGAAGCGCAGCCTTGTGCAGGCACTGGGTCAAGCTCGTGACAATGTGGCTCCCTCGACAGAGAGTGTATCCCTACCAGGAGAAACCTCGGTCGCCGGC
GCCCCTACGACATATACTGCTGACAGCGAGGCCAGCGT