Description :
From Genome Similarity Track
Location :
Scaffold_1:1014126- 1015429
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00245tryptophan synthase beta chain
Phypa_INRA-310PPTG_00246AP-2 complex subunit mu

Sequence
1303 bases(100 bases per row)
CCGTGCTGGCCGGCGCCAGTCTCGGCGATAATGCGTGTCTTACCTAGACGCTTGGCCAACACGGCCTGCCCCAGCGCGTTGTTGATCTTGTGCGCGCCCG
TGTGGGCCAGATCCTCACGCTTAAGCCAGATCTGCGCACCCTTAGCGTGGGCCGTCAGGCGATTGGCGTGGTACAGAGGCGTGGGGCGGCCGATGTAGTC
GCGGCCTAAATGCTCCAGCTCCTCGCGGAAGGCCGGGTCCTGTGTGGCCTTGACGTACTCGTCGATGAGGTTGTGGTGCGCCTGGATGAGCGTCTCGGCC
ACGAAGCAGCCGCCGAACTGGCCGAAGTATGCGTTCAGCTCCTCGGCCGACGTATACACGGGCGGCGCGTTGGACACGTCCAGGTACTTCTTGTAGTTAG
TGCTGTTGTCGGTCATCGCTGCTTTCGAGACGGCAAATTAGAGAGTGATGGAGGACGAATCGGTCGCCTCTGACGTAGATGGATGGAGCCACCGGAAAGT
GGCGTCAACAATTGTCACCGAACAGGTTGATGTTGATGCGCATTCGTACACTGACCTGTACAGACTCGATGCTGAACTGTGAAGATGAAAAAGACAAGAA
ACAAAGTCTGGGATAAATGGTGAAAAACCCACTCCTCGATTTGCTTGGGAGCAATATGTACAACTCTTTGCTGTCTGATTCCACAGCCTATCAGACACGG
ACCACGAAACGCGTGAATAAGGTAACTAGGCTCTGCGGTCTGAGGTGCTTGGGGTAACACCATTAAGGAGCCGCTCCTCATGAGTCGTGTCTTGAAAGTT
TTGCTTAAACTCGTTTAAAACGTAAGTTGCCAAGGCAACTTTTCAAACCTTGAAACTTGACTTGCTGAGCATGAAACACATGATGAAGGTAAAAATACTT
AAGCCTTCATCAAGCTCAAGCTATACAAAATCTAATGCGAAGCGACGCAGCGCAAAGCGGTCGTTACGCTTGCTTCCGCCACGGGATTTCTCTTCTCGAC
CGGTCGCATCAGTCCTGGAAGCGCAGCGTGGAGTAGATAAGCTCTTGATTCTAAACCTTGATCCACCATAACAAGTTCTTGATCCGTGTCCACCATGATC
AGCGCCCTGTTCCTCATCAGTCAGAAGGGTGAGGTAGTGCTCAATCGCTTTTACCGTGACGATGTCAGCCGACGCGCGGCCGACAACTTCCGACTGCAGG
TGATCGCGGCCAAGGAGACGGGCACGCTGCCGCCTGTCAAGGTCATCGACGGGTGCTCTTTCCTATACACTCGTCACGAGAACTTGTACCTGGTGGCTGT
TTC