Description :
From Genome Similarity Track
Location :
Scaffold_3:10140- 11354
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_3-snap-gene-0.50Ankyrin

Sequence
1214 bases(100 bases per row)
ACTTGACGATCTTGAGATGTCCATCTGCAGCAGCTCCATCCATAGCGTCCGTGCGACATCCTTCGCTTCGATTCGCGTGAAGCCAGTAGACCATCTCCAG
GAAGCCTTGCTGTGATGCCCAATCCAGTGCATCCACTGTACATCCTTCGCCTCGGTGCTCATGGAGGAATCGCACAACTTCGACGTGGTTCCGAGACGCA
GCTAGATCCATCGCCCTTGTTGTACAGCCCTCAGTGCGATGCGTTTGAAGAAACTCGACAATGTGAAGATGTCCATTCCCAGCAGCTTCGTCCATCGCAG
ACGTCGTGCATCCTTCAGACCGGTTTTCATGAAGAAACTTCACGACATCGAGATGACCTTTCGCTGCCGCCCAGTCCATCGCTGCTTCGGAGCAGCCCTT
ACTCCCGTCACCGTCGTACTCATGAAGAAACTTGACAATTTCTAAATTGCCGCCTAGAGCTGCGCGGTCCATGATTTGATGATACTCGAAAGCAGAGCTT
TCTTCTTTTTTTTGGTGACAGCCGAGAAGAAACTTGACGATCTCGAAATGACCGTCTTCCGCGGCGAAGGCGATGTCATCCTCTGACGTCTTCTCTGGGT
AGTGAGCGTAGAGCCACTTGATGACTTCGAAATGGCCGTACCAGGCTGCGTATGAGCTGGCTTGATAGGTGCACCCGGATTGGCGATTCGCATGCAGCCA
CTCGATGACCTCCAAGCGACCGCTGCGCGCTGCACTATCAACGGCGTCAATCGAGAACTCGATTGTTGCGTGCTGGTCGAGCCACTTAATCATCTCCAGG
TCGCCACGACGAGCGACTTCGTCCATTATCTCGACAGGCACACGTGCGCCAACGATCCAGCCGCTGAGCCACTTGACGATACTGAGGTGGCCATCATTGA
CGGCACATTCGAATGCAAGGCTCAGAAGCCTCGCAGAGAGGCCGCAGTTCTTCACAATCCACTCCAGCATGTGGACATGTCCGTTCCTCGACGCCCGCTC
GATCGCCATCTTCATGTCGTCATCGTCGCACCCAATGGAGCAATGATCGTTTATCCACTGAATCACGTCCAGATTTCCGCTCCCTGCGGCGGCCACGAAA
ACATCCGAGTCGCCAACAGCTTGCGGGTTTGCAGCACACAGCATCTTCAGTACGTTCAAATGACCAAGCGCTGCCGCTATTTTCGCGGCATCGACGATGT
GGAAGCGCAGGGAG