Description :
From Genome Similarity Track
Location :
Scaffold_3538:1014- 2358
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3538-fgenesh-gene-0.0Alpha-ketoglutarate-dependent sulfonate dioxygenase

Sequence
1344 bases(100 bases per row)
CCTGAGGCCACAGCTCCTTCCCATTGCAACTGTAGAGGGAACGCAGCAAGCATTGGGGTGAGTTTTCGAGAGCATCACAGCTGATATTTTTTGCTGCGTA
CCTTGCTGCTGTGGATCGCGGTCAGACCTTCAAGGAAGTTCTGGAGCGGAGGCGTGAGGCGCTCGTAGGCCTCGTAGCCGGAGGCCCAGAGGGTGTCGCC
ACCGACATCCGGGGTAGTCAGCAGCTTGAAGATTGTGTACGAAGGTGGCTACAAGGTACACAATGATAGATTAGCAGGCAGCAACAGTATCATAGGCTCA
ATCGATACAAACGATGCGTACCTGACGCTCGTTCGACGTGTCGCTGTGCCACAAGTTCGTTGGCTCGTAGCGCTGGCGCGCGAGCAGCGCCGCGCTCTTC
TCGACCGAGTTCTCGACCGACACGACTTCTGGGTAGCCTTCTGGGTGGCCCAGGTTCTGGTGGATGTGCAGCGGTCCGTAATAGCGGCCGAGCGCCACCT
GCTGGTCGATATCGAGCGCCTGGTCACGGAAAAAGACAACACCACGCTGCGCAATGAGCAGCGCCAGCTCGTCCTTCTGCGCGTCCGAGAGCTCATGCAG
CTGGATCCCAGCGATCTCCGAACCGATCTTGGGCGACAGGTGCGTGATCGTCACGTCCCCAGCGAGTAGGTTCTTGAACGTGGAGTCGGCGTTGAGTGCG
CGGTCTTCGTACGGCAGCTCGGGGATGACTGGGTACGTGGTCTCTGGGAAGACGCTGAGCAACTCCGGGTGGTCGAACTCGTGGTGCGTCGCCTCCTGAT
TGAGCGCGTTCTTGATGGTCACGGGCGCCTTGGCAGCCGTACCAGAAGCAGTGGGGTCGGTCTCGTGGTTCTGTGGCGCCATCGTGAAGCGAAGTTTCTT
GCAAAATGGACAATGAGATCCAGGAGTTCACTCGTGTGTCAGCGGCTGGAGAGTACCGTGGTGGACACAACTGCTGGTGATTGACTGCAACGGTACGCTG
CCGCTGGACGCGTGCCCATGGCGCGGCGGAATGCGTGAACGAGTCTCACTGGAGATCCTTTTGAGCTTCACTGAGAAGCTCCATTGAGAAGTCGACGTGT
GTGATGGGCGGATCCGAATGCCAGTCGCACCGCTTGTAGGTCTTCGCTAGTCGCCGTGTTGGCTTCCTTTGCGCTGATTGGTGGATTTTGAAAATGACGA
AAAAGCCAATTGGCGAATCAGATGCCGAGTTCGCGGTGCGTATTCGAATACGAAACCAAATCCTCGAGGTCTCTCGAGGGCCGTCAGCGAAAACGGGACT
TGAAGTGGACGAACTGCAATCGCGACCATCTGATTCAGATGCAA