Description :
From Genome Similarity Track
Location :
Scaffold_138:10139- 16657
Sequence
6518 bases(100 bases per row)
CCATGTGCTGCGCCCGCTCCGCGACTTCGCACCGAGTTATTTCGATGACATCTTCGTACACAGTCGCGCTGAGGGAGGCCTCAGCGCGCTTGAAGTTCAC
TTGAAGCATCTGAGGCAAGTCTTCCAAGTGATGCGCGAAAACAAGCTGTATGCCAACTTGAAGAAGTGTATATTCTGCGCGCCGGAGATTCCGGTGCTTG
GCTGCTTTGTGAGCAAGAAAGGCGTCCGCGCCGACCCCGAGAAAGTGTCGTCGATATGTGCGTGGCCTACGCCACAGAATCCCACTGAACTGCGTCAGTG
GCTGGGTCTCGCAAATTATCTCCACACGTACACGAAGAATTACGCCGGATTGATCCAGCCGCTCTCTTCGTTGTTGAAGAAAGATGTGTCGTGGTCGTGG
ACTTCCGCACATCAAGCCGCCTTCGACTCGGTGAAGAAGAGTCTCGACGAGGCCCCAATCCTCGCGCTCCCGGATGACTCGAGGCCTTTTCACGTCGTCT
GCGACGCGAGCGATTTTGCCATCGGCTGTGGGCTGATGCAATTCGATGAAGAAGATCGAGAGCGTGTCGTAAGCTACCATTCTAGGCAGATGAAGCCGGC
GGAGCGCAACTACCCTGTTCACGACAAGGAGCTCCTTGCGGTGCGCTACGCTCTGATCTAGTTCAGAGTGTACTTGTTGGGTGAGGATACCTTCGCGGTG
TACACCGATCATGCATCGCTGAGGACAGCGATGAAGAGTCCTCATCTCTCCCAGCGGATGGCCCGCTGGCTTTCGTTCTTCTCTGAGTACAACTTCGTTG
TCCACTACAAACCCGGCAAGAACAACATTCTCGCCGACGCTTTGTCTCGGCGTCCCGACTACGACCCACGCGGTGCATTGGGTCGACAAGCTTCGCTGGA
TGAAGACGATGTAGACGAGTGTGCCATGTGCGAGGCGTCAGGCGTCAACCTGACGAGCGTCTCCCCGGTAATGCCACTTCGCGACGAGATCCGAGCTGCT
TACGAACATGACTCGACGTGCTCCAGTATCCTGAAGCATCTCCGCTCTCCCAGCGCCGACACACTGGGAGCCCTTTCCCGCTCTGTACGAAACAAAATCC
ACCGATATCGTCTCGAGGACGAGCTGCTGGCGTACAGCATCGACAACTTCGATGCCCCACGTGTCGTTGTCCCTAACGACCCCGATCTGCGCTCACGGAT
TATCCATGAGTTTCATGATGCCCCGCTGGGCGCTCATCTCGGTCGCGAGAAGACATTTGCCGCTGTGTCACGCGACTTTTATTGGCCACACCTGTACAAA
TGGGTGCGTAAGTGGGTGCGCACCTGCGAGACCTGCCAGCGCGTGAAACCTGCCTCGTCTTCGCAGGCTCCCTTGCGTCCTCTACCAGTGGCCACCGAGG
CCTGGCGCTCGGTGTCGATGGACTTCATCTTCGGGCTCCCACCCGATGCTAAAGGACGATCAGGTGTCTTGGTATTCGTAGACCGCTTCAGCAAGATGGT
TCACCTGATTCCGGTGTCGGATGCGATCACCGCGGCAGATACCGCGGTGCACTTCCTTGATGCCGTCTTCCGTCATCATGGCCTTCCCGAATCTATCGTC
TCCGACCGCGACCCGCGCTTCACGTCGGCCTTCTGGTCAAAGCTCTTTGAGCTACTGGGCTCGAAGCTAATGATGTCCACAGCAGCCCATCCGGAAACGG
ACGGCCAGACGGAGCGCGTAAATCGCGTCCTCGAAGACGTCCTTCGAAGCTACGCGACGTCGTTCTCCAGCTGGAGCTCGTTTCTGCCACTGGCCGAGTT
CGCTCTGAACAACGCGGTACACGCGTCGACTGGGCTGACGCCCTTCTTCGTTAACAACGCACGACACCCGCGTGTCCCTGCTCTCCTCGCCGTGGGCCAT
CCCACAGCGCCGTGTGTCTCCACTCTGGGTGGGGAAGAAGCTGCCGACAAGCCGTCTACTCCATCTGCGATGTCTCCGGCGGCTACACCGGTACTGGGTC
AACGTGTATATACACCGGTTGCTAATGATATCTCGAGTGTATCCCCTGTTCCCACGTCGGTCAACGCAGTGACACGCTCCGCATCGAGCTCACTTGCGCC
AGCTAACTACGCGCCGAAGCATGCGGCGCGACCAATCGACTCCGCAGTCGTCTCCGACTTCGTACTACAGCGCCAAGCGGTCACCCGCTATGTTCGTGAC
GCACTGCAGGACGCAGTGGACAAGCAGAAGGAGAACGCTGATAAGGCTGGCCGCAAGAACACAGCCACGTTTACGACAGGCGAACGAGTGCTCCTGTCGA
CTGAAGGTATCAGAAACTCTGCGGTTACCAACCTCGGCGCGAACAAACTCGCGTCGCGCTTTATTGGGCCGTTTACGGTGATCAAGACCATTGGTGACGC
TTACACTCTGGATATTCCTTCGACACTACGGCTACATCCGACGTTCTACGTCGGACGTTTAAAAAAAATACCATCCGTCCGAGATCCCGGACGCTGATTT
GTCCTCGAGTGACGCGGCAACTTTCCAGCGAGATGGTCCTCCTCCTTTGATCGACTCTTCGGGCGCTCAGCGTTGGATCGTTGAGCGAATCGTCGACCAC
GACTTTCGCCAGTGTCATGGTACCCGTGACGGTCACACTGAAGCGTTTCCACAGGGTCGCGCCCTGCGGGACATGGAACAACACTATCGCGTGCGTTGGC
TGGGACTCCCCCCAGGTGAAGATACTTGGGAGCCGCGCAGTCGTTTGCGGGAAGACGTTCCCGACATCGTGAACGAATACGAGAAGACACTCACGTTCCG
AAGCGTGAGTGAGCCGGGTGCTGATATCCGCGGTGAAGAAGGCGACCAGCCTCCGCGGGTACACGGAGGCACTCGCCATGATGATTAAGAAGAAAACTGG
AGTTGACGCCGGGATCGAACCGGTGACCAGCTATACGAGAACTCGGCACTGTACCGCTGAGCCCCTCGGTGAGTAAGCCGAGTGAACAAATGAGTGAGTG
AGTGAGTGAGTAAGTGAGTGAGTGAGTGAGTGAGAGCGAGTGAGTGAGTGAGTGCGGCGCGAGTGACGCGAGGTTCCACGACGACGAGTGAAACCCCAGC
TCGCAGGTCACCTATATTCCGACGTCGCAGTCGCATGGGTCTACAAGATACTTCTTCGTACGCTGTGCAGTCGCACATCGTCGCTCAGTCAACTGAGCGA
AGTGGTTGTCGTCCCCGTATTCGCAGTCTCAAGTACCTCGTGCGCTGTCTTCGTGATCCTCGTGTCTGCTAGAACATCGTGGACGTTCCACGATGAGCGT
ATCCCCAAGCACAAGAAGTCTCCAGTCGGCGCTCAGTCTTTGCGTCTGTGGTGATCATCGTACCAGCGTTTCCTTGCAAAAACACTTGCTCGTGCTCTTG
TCGCGGAGTTTGGTCTCCGTGGGAATCGAACTCACGCGTACTGCGCGTGAGCATGCTCCGTTACCCGCTCGGACACGACGTCGCAGAGAATTTGATGCGC
CTCAGGACAATTCCAGAGGTCCAAGCTTCACTCCACCAGAACCTCACCTGGCGCCTCGAAGCCCACGTGTGTCGACACCAGCGCCAGCGACGGTGGCCTC
CAAGCTGTTGTCTGAGATGTTCTCGCTCTGCACGCTCGTTGCCGAGCGTGGTGTCTCTTGTTGATACGCCAGTGGCTTGATGTCGTGAGTGTGGCCGATG
TCGCCGCTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCGTGCCCCGTGCGCTGCGGTCGACGTCGCCGCCGTCGTCGGTGTCCCCGTCCGCTGTTGATCCATCGTGCTGTTCGTCGTCTTCTCCGC
AAGTCGAGTTATGTCGCTCCTGCGCTTCGCAGGAGATGTCTCCGTCTCTGTTTCGCTCCGCCCGTTAGCCAAGTCCCCGTTCGCCATCCTCACGCAGATT
GATTTGTTCTTCGCCCACTGCTTATGTTGCGTAAGTGCAACTTTAAGAGGGGGGGGTAGTGTAATGGGCCCCTCCATTACATAAGTAGGTAGATTTCTTT
ACAAAAGTAGGTACATCAGCACACGACTAGCGTGTGCTGAAATGCTGTCATGCCATTGGCTGATATATGGGGAGCCAGACCCATTATTAGCCAATTGGAC
TATGACGTGTATTTGAGTGGCCAGGGCTGTGGCCTTGGTCCTAAAATAAAGTCAGAGCTGATTTTTCCTTAAACCTAAGACTCAGTCGTCCTATTGCGAG
CTTCCTCAACACTATAGTGTAAGCAAGTAACGGAGTAAATACCTGGCCCGTTACGGCAGTAAGGCGAGACATCGAGCTTGACGCTTGTTCTTGGGCGACG
TGGGAGTCTACACTCGCTGACCAATGTCTGCGCGTTCACGCTCCATGAGCGCCTGGGCGACCAGGCGTTGTTGGGCTTAAGACTCGGCCGTAAGAAAGGT
TGGATGACGGCCTCGCCGGACGCGGCGGCGAGGCGGTGTAGCACCTCCCACTGTAAGACGAGAGATTGGGGAAACTGCAGTGCTCCGATCGCAGTGCGAC
TTGCACAGTATGATAGCGTATTCACTGCCAGAACAAAGTGTCTAAATACAGATATATACATGAACTACATTTATACTTAGTAAACAGAACGAATATCGCG
AAGCCACTGGCAAAACAGTCGCGAGCTACGTATATCGATTTGACGCTTTGCACAAATTCGACACGAAACGAAAATTAATTTGAGAGTGGTTGGAACCCCC
GCCTGTGGAGACTCTTCAGGATTTGAAAAAATGGACGCTCTACGAACGCTCTTGTCTCAAATCGCTCCGGACCTCCCAGCTATCCGAACGACGTATACGT
GTATGCATACGTGTATGCAAACCACTCATTACGCATTCCCCCCCCCGATCGACGGAAGCCAATGAACCCGGCGGAGCGAATGCGACGGTCGGCGCGGAAA
CGTGTGCCCCCTGAATCGGACAGTGACAGCGATTACAACGTAGATGACGAGAACAGCGTTAGTGACGGAAGCGAGTTCGCGCTAGGCACGACGTCGAGTT
CGACGGAGCATTCAGACAAATCAAGCCGCTCGGAAGACCTTTATCCTCAACATTCGACTCCTCCCCTTCCTAGCCGCACCGTCTTCGAGTCGTGGGATGC
GTTCGACACGTACATCCGCACATACCAAGCGGAAACGTACCAGGTAAGGTGTATTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNN