Description :
From Genome Similarity Track
Location :
Scaffold_550:10139- 13556
Sequence
3417 bases(100 bases per row)
CTACAAAGAACCTATAAAACTAACTACATATGTAACTTGGGAGGGCCCATTACATCACCCCCCCCTCTTAAGACAGCAATCACCTAACGTGGGTGCACTT
CGGAGAACAATCGGGAAAAACGGGGAAATGGCGGAGAAGAGAATGCTTGAGAACTTGACGGGCGGGAGCTCCTGCGAAGCCCAGGAGCAGCACAATACAA
CTTGCGCGGACGAGAACAACATGGCGCAGCAGACGGGGGCGGTGAACCAGACAGGAAGCTGAACAACGCGGACAGCTCCAGCGTCGGCGACGACGCTGAA
CAGTGGGTGGACCGCTGATATCTCACCTGAGAGCATGAGTCGACTTGGGGTTCGGCCCGGCGTAATGAACGAGGATATAAAGCCGTGGGCGCTGTACGAC
TTGTCCGGGGCGGTGACCCCGGACGCGCTGGACATCATGCAGGACCACGTTCAGCGCTTCAGGCGTCTCCGGAACAAAACACTCGACGACGCGTTGTACG
AAGCCTTACAGAGATCATGGTGCGCATTCATCCGGCGGTGGAATCGGATGCAAGAGGCTGAAGAAAGTGTCGTCGGCTGGCTCGGTGATCGTGAAGCCCT
ACAAGCCGAGCATTCACTCGGTGATGTGCGCCTGAAAGTCTGCGACAAAGCTTGGACCGAAGACAGTTTGTGCTATGTCAACGTACGCGAAGGTTGCAGT
TCGTGTGACATCGGGCGACGCCCGACGCAAGCTGAGTGGGATCAGCATATTGTCGAGTATCCGCTCATGCCGACCGAACACGCTTGGATCAAGAAGTATA
AGCGCTTACTCTCCATGTTCACCCAGGCAGCTATTCGTGGCGGCTCGCGCCGACAGCGTTCGCGACGGATCCCGTCTCCGGCGCATTCGACGTCTCGTCG
GGAGCGTAGTCGATCGCGTTCTCGATCGCCGCGAGGTCGCTCGCGGCCGCGTTTGACTCAAAGCTGGAGTCGTACTCGTGGACGACATCAGGAACGTCAC
GAAGCAAGTTGGCGCGAGGCTCCCACGTATCATCAGCTGGTTGAAACCCGATCCATCATACCTTATACTTCCGCGCGGCGGGAGCTGCGTGTTGAGCCGA
CGACTTGGTCAAGTTACGCGCGCGGGGAGGATCTTCGTGATCAACAATACGGTCCACGATCCAGCACGTATCCCCATTCGAGTCAACGATGGGCGGAGGA
CCGTCGCGGTGGAATTCGACGCGACCTGGTTGACCAGGACGACGTTGAGAAGGCGCTGAACACTTCTCGGGACGGACAGGAGGAGGCCGAGCGGGCAGCA
TAGAGCTCTCGGAGCGCCGAGACGACGGCGAGTAGTCTGCGGCAGTCGAATCGTGAACCCTTGCAGCGACTATGTAGTCTGGAGGCGCAGGTGTTTGGCG
GACCGAGGAGTGGAGCTCTTCCGCGCGAGGGTGGAACTGGGACAGATGGGACGCTGGCTCGACAGGCTCGTCGCGAGGGTCGCTCAACGCATACTCCTGT
TCCGCCTCCGGGATCGTCGCGGGAAGATACTTCTTAAGTCGCCCGACGTAGAACGTCGTGTGGTGTTGGAATTCCCACGTGAGCTCTAGCTACAAATGTA
GTTAGGACGTTCCCACAACAATACGTCTACTAGGATAGTAAACGATCGTTCGGGCGGATCTGAAGACCCCAGTTCTGCCCTTGCGCCGGGACAAACTGGA
CCTTGTAAACTACTTATATAGGCCAACCAGTAAAAATAAGAACACGCTACTAGCACGAGCAAAGCTAGCAGGTGTTTTGAATCCTCGTGGTCCAAACAGC
GGAAGGATACCAGACACGGGTAAGCCTTTTACGAGATCACCGAGTGTTCAACACTCGGCTGGAAGAATAAAAAGGGATGCAATACAAGCACTCCCAGTCG
TGCAAATAGGCAACAATAAGCCGTCACGTAAAAACCTCCCGATAATAATCGGCCAATACACAAAGTCTCTTGGCCTTGCCGGATGAACCCTCGCTACAGA
GCTTCGAGTTCACTGACAGGCATAACACACTCAAACAAGCTTGGCCTGACGCTTACCTTGAAGCCGGACGTCGCTCTGTGTGCTTGAGTGGAAATTCTGT
TCTGTATTTAAGCTTACCCTTTCGGGTCTATTCCCAATAAGAAGTCCTAATCAAGTATACAAATATCAAGTAAACCATGATCCGTTATGGATCTTCTGGC
ATGCCAAGCGTCGTCTGCACCGTCGCACGAGCATCTTTAACGGTCCGCGCCCTGTCCCAGACGGTGAACGTGTCTTCCAAGGGTCGCTGAGTCTTCCGCG
AACTCATCCCAACCGCCACTGAGGGTTCGTACCGTAGATGGTCCGCTGAATGCGAATCCGGCCAGTCCATTATTAATAATAAGGACAGCCTGGATTCAGT
TACATATGGCCGTATCCAATACTCGTCGAAGGGTCGGGAGTGACGCCGTCGAGTCCCTTGCACCTTGGCGTCTCCGTACATCACATGACCGAGGGTTCGT
TGCTTGAACATCTTGGGCGGTGTCACGTCTTTGTCGACGGGTGATAATCCGCAACTACGGAGAAATCACTACACCACAACTGCCCCTGTCGCAATGGAAG
CCACGGTACTGGTGCCCGTTGTGACATTTCTTCATTCTTCAATTCACCATCTCGCCACCGTATGTCCGAGCGTCTGAATCGAGCCGTGTCCGACGCGTTT
CAGCGTCTCAATCCTCGTAGACGTCGCGAACGTGAACAGCAGGAGGTACGTCAGCTCATCCTTCTCTTGAATCATCGGCACCTTGCTTATCACCTCGCAT
TACTCGACTTGTTTCTCAGGAGGGCAAGACCGAGGGTTCGAACGCCCCTCAGTCTGCTGCACTTCCTCCGACAGCAGCGTCATCAACCGGTCCTCCGGCG
CCTGCTGCCCCGGACTTTTCACTCCCTGCGATAGCTCCTGCAGCACTCCCCGTCGTCGCTAATTCCGCGGAGATGGCTCCTGCTGCTCCTCCTGCGCCTG
CTGGTAGTACACCACCACTCACCGAAGATTCGCTGCGCGCCATGCTGGCTGAAAGTACGGAGGCATCGGTCGATCACATGATGACCTCGATAATCCCGTA
CTTGACTGCAATGGCTCGTCACCAAGTGCAGCTCAGCGTTGCGCCTCCTCTCCTCGGCGATGTACACACTCAGCGTCGCCTCGAGACTGCTGTTGGTTTT
GATGATGTCCTCGCTGCGGTACAACCTATTCCTGACGCGCTGTCGGCATTACCCGAGCGAGTCGCCGACTTGGAGCTTCAGCTGCGGTTTGCTCAGTCCG
AGGCTGCTGCCGTCGCACTTTCGGTGGCACCTGAAATCATGGCTCGTGAGAACACGGAGGCGTTCCTCAAGGCTGCCAACCAGACACCGACTAACGGAGG
GGTCCCCCGATGATCCG